Brain derived neurotrophic factor ( BDNF ) Essay Example

Brain derived neurotrophic factor ( BDNF ) Essay Understanding BDNF Brain derived neurotrophic factor ( BDNF ) is a neuro-chemical ; it is portion of a household of protein molecules called neurotrophins ( Binder and Scharfman, 2004 ) . Although originally purified from the mammalian encephalon, it can besides be found in many countries of the CNS and PNS. In order of find, get downing in the early 1950 s was nerve growing factor ( NGF ) ( Levi-Montalcini and Hamburger, 1951 ) , 2nd was BDNF, which was purified from the hog encephalon ( Barde et al. , 1982 ) , so neurotrophin-3 ( NT-3 ) ( Maisonpierre et al. , 1990 ) and neurotrophin-4/5 ( NT-4 ) ( Ip et al. , 1992 ) . These four structurally related molecules constitute the protein household of mammalian neurotrophins besides known as growing factors. Neurotrophins have three chief maps: To advance the endurance of bing nerve cells ( Hempstead, 2006 ) . To excite nervous development ( Hennigan et al. , 2007 ) To bring on map of nerve cells ( Reichardt, 2006 ) , which may affect neural counsel, connectivity and synaptic malleability. Neurotrophins bind to a specific receptor in the cell membrane, which induces a conformational alteration in the cell surface receptor, therefore doing a signalling cascade that alters cistron written text and look, normally stoping in growing and ramification of the nerve cells. Interestingly, the term trophic originates from the Greek word, trophe , straight translated as nutriment. BDNF is a 12.4 kDa basic protein, which is good known for its modulatory function in the development, care and endurance of the nervous system, peculiarly in the turning embryo go oning through to adulthood. BDNF is necessary for normal development as shown by a survey of mice born without the BDNF cistron. The consequences indicated developmental defects in the encephalon and centripetal nervous system ( Ernfors et Al, . 1995 ) . Furthermore, the bulk of the mice with the BDNF strike hard out phenotype did non last passed the 2nd station natal hebdomad. The BDNF mutation mice showed a 65 % loss of nodose ganglion and a 30 % loss of lumbar dorsal root ganglion nerve cells, showing that physiological concentrations of BDNF are necessary for neural endurance of peripheral centripetal nerve cells in vivo ( Enfors et Al, . 1994a ) . Additionally, they suffered from a deficiency of vestibular maps such as co-ordination, balance and hearing due to cerebellar abnormalcies ( Fig.1. MGI datab ase: phenotypes for BDNF homozygous void mice ) . BDNF map and mechanism of action We will write a custom essay sample on Brain derived neurotrophic factor ( BDNF ) specifically for you for only $16.38 $13.9/page Order now We will write a custom essay sample on Brain derived neurotrophic factor ( BDNF ) specifically for you FOR ONLY $16.38 $13.9/page Hire Writer We will write a custom essay sample on Brain derived neurotrophic factor ( BDNF ) specifically for you FOR ONLY $16.38 $13.9/page Hire Writer Without growing factors like BDNF, nerve cells decrease in functional activity and cut down strength and figure of connexions to other nerve cells. When BDNF maps as a survival factor, it is picked up by peripheral marks via TrkB receptors, and so transported retrogradely to the cell organic structure where it will act upon cistron look and other cellular procedures. Alternatively, BDNF can be produced in cell organic structures of the PNS and CNS, where it is packaged into dense nucleus secretory cysts, and so transported anterogradely to pre-synaptic terminuss for exocytosis ( Alter et al. , 1997 ; von Bartheld, 2004 ) . BDNF is expressed by a subpopulation of little diameter centripetal nerve cells with unmyelinated axons ( C-fibres or nociceptive primary sensory nerves ) , here it is anterogradely transported to their cardinal terminuss that synapse in the superficial laminae of the spinal cord dorsal horn. BDNF is a regulator of neural irritability and modulator of synaptic mall eability in the cardinal nervous system ( Le A ; szlig ; Manns and Brigadski, 2009 ) . Assorted pre-synaptic and post-synaptic actions of BDNF have been addressed in GABAergic and glutamatergic synaptic transmittal ( Carvalho et al. , 2008 ; Lu et al. , 2008 ) . So far BDNF has been mentioned to demo a trophic consequence in sensory and vestibular nerve cells, there are besides surveies that have revealed BDNF exercising its trophic and protective belongingss on motor nerve cells ( Koliatsos et al, 1993 ) . One such survey showed that presenting BDNF after spinal cord hurt induced functional recovery ; axonal germination and protection of corticospinal nerve cells ( Sasaki et al. , 2009 ) . A 2nd survey showed that BDNF prevented excitotoxic glutamate receptor mediated cell decease in civilized embryologic rat spinal motor nerve cells. The mechanism involved the activation of the TrkB signalling pathway and the PI3 signalling tract ( Fryer et al. , 2000 ) . Furthermore, important Numberss of motor nerve cells were spared upon add-on of BDNF to lesioned neonatal sciatic nervus or facial nervus rat theoretical accounts. Another survey portrayed BDNF as an repressive agent of normal cell decease of embryologic biddy motor nerve cells ( Oppenhei m et al, 1992 ) . BDNF has besides been shown to originate the self-generated and impulse-evoked synaptic activity of turning neuromuscular synapses in civilization ( Lohof et al, 1993 ) . On the other manus, an over-expression of BDNF in the prosencephalon was seen to do acquisition and memory damages ( Cunha et al. , 2009 ) . The surveies show that BDNF plays an of import function in the development and operation of sensory and motor nerve cells. BDNF synthesis depends on ordinance by neural activity and specific sender systems ( glutamate and GABA ) . The BDNF molecule described so far is a neurotrophin in its mature signifier, it is ab initio synthesised as a pre-proprotein in the endoplasmic Reticulum ( ER ) . The pre-domain is instantly cleaved off, go forthing the direct precursor, proBDNF. ProBDNF can undergo more post-translational alterations via the Golgi setup and trans-Golgi web ( TGN ) , finally go outing in secretory cysts. The proteolytic cleavage by convertases produces the mature protein that acts on the nervous system. The convertase enzyme, Furin, is what is believed to split proBDNF into the mature homodimeric protein ( Seidah et al. , 1996 ) . BDNF secernment There are 2 secernment tracts: 1 ) the regulated tract affecting Ca2+-dependent exocytosis of secretory granules and 2 ) the constituent tract covering with specific cysts, which release their contents on attack to the plasma membrane. The spliting off procedure of the pro-domains can happen throughout both tracts ( Le A ; szlig ; mann A ; Brigadski, 2009 ) . BDNF molecules are co-stored with neuropeptides in dense nucleus cysts ; nevertheless it has been shown that they are likely to be released individually, depending on stimulation forms and frequences. For illustration, the neuropeptide, substance P is released during changeless low frequence or tetanic high frequence stimulation ( Mansvelder and Kits, 2000 ) whereas BDNF release is reliant on synaptic presence of peculiar stimulatory molecules, including extra-cellular [ Ca?+ ] and capsaicin, affecting NMDA receptors ( Lever et al. , 2001 ) . BDNF signalling tract BDNF has distinguishable signal transduction tracts, triggered by its binding to a specific receptor. There are 2 chief categories, the predominant and high affinity TrkB ( tropomyosine kinase B ) receptor and the low affinity p75NTR ( neurotrophin receptor ) . Merely upon binding of BDNF will a signal transduction pathway be activated. Binding of a putative ligand to the TrkB receptor elicits dimerisation in which the receptor becomes catalytically active ensuing in autophosphorylation ( conformational alteration ) . This is closely followed by activation of the legion signalling Cascadess, including the undermentioned intracellular tracts ( Hennigan et al, 2007 ; Binder A ; Scharfman, 2004 ) : PLC- ? 1 ( Vetter et al. , 1991 ) , PI3-K ( Atwal et al. , 2000 ) and Ras/Raf/MAPK ( Thomas et al. , 1992 ) . Briefly, there are 3 Trk neurotrophin receptor subtypes: TrkA binds NGF, TrkB binds BDNF and NT-4 and TrkC binds NT-3 ( Barbacid, 1994 ) . As antecedently mentioned, the low affinity p75 receptor, non merely binds BDNF, but besides all neurotrophins both in their precursor and mature signifiers. Lu et Al ( 2005 ) declared that mature neurotrophins tend to preferentially adhere the Trk receptor, ensuing in a pro-survival consequence, whereas the proneurotrophins, which have a higher affinity for the p75 receptor over the mature neurotrophins, appear to modulate cell decease. This led to the yin and yang theoretical account of neurotrophic action. This thesis will concentrate on the pro-survival consequence of BDNF. BDNF look BDNF activity has been observed chiefly in the hippocampus, cerebral mantle, cerebellum and basal prosencephalon. These are cardinal countries for acquisition and memory, which is why it has been associated with synaptic malleability and long term potentiation. Synaptic malleability is defined as the activity-dependent selective strengthening or weakening of a synapse between two nerve cells so that information can be collated, managed and stored in complex nervous webs ( Waterhouse and Xu, 2009 ) . Despite its terminology, BDNF look can non merely be seen in the encephalon, but besides in other countries of the CNS, the retina, motor nerve cells, the kidneys and the prostate ( Chao, 2003 ) . Besides, after peripheral nervus lesion, BDNF look was shown to increase ( Meyer et al, 1992 ) . BDNF is expressed in musculuss and is upregulated in denervated musculuss ( Griesbeck et al, 1995 ) . The old surveies provide grounds to back up the growing factor features of BDNF and for the gener alization that BDNF is widely expressed throughout the nervous system when required. A developing point being introduced is that in state of affairss of nervus harm, there are marked alterations in BDNF look. Neuropathic hurting Pain is the feeling encountered after a tissue hurt, due to a mechanical, chemical or thermic break to the excitations of the affected country. The nociceptors are activated via noxious stimulations, which fire action potencies along Ad and C fibers ( primary sensory nerve nerve cells ) towards the dorsal horn. Ad fibres detect heat, are 2-5 Â µm in diameter and have a conductivity speed of 2-5 m/s, synapsing straight on to secondary sensory nerves and go uping contralaterally via the spinothalamic piece of land. C fibres detect heat, cold, scabiess and noxious stimulations ( polymodal ) , are 0-1 Â µm in diameter and have a conductivity speed of 2-5 m/s. They enter the substantia gelatinosa of the dorsal horn laterally and synapse on an interneuron. The GABAergic interneuron synapses with a secondary sensory nerve and ascends contralaterally to higher Centres via the spinothalamic piece of land. Acute hurting is an immediate warning to the encephalon of tissue harm, signalling via nociceptive transmittal and hence moving as a mechanism of protection. Normally, nociceptive information from peripheral stimulations undergoes treating within the dorsal horn, so that the information the higher Centres of the CNS receive is a just representation of the extent of peripheral nervus hurt, regulated by inhibitory and excitant transmittal. Otherwise termed, nociceptive hurting ( Woolf and Salter, 2000 ) . Simply, a break to this system is what causes chronic hurting. Chronic hurting means that the normal inhibitory/excitatory regulation and dorsal horn processing of the nociceptive input has been disturbed. Some critical cellular, morphological and therefore functional alterations occur in the dorsal horn, which increase transmittal of noxious spinal end product taking to a more long term status. Assorted mechanisms have been implicated that influence the inhibitory/excitatory ordinan ce, which appear to meet to the engagement of neuronal-glial signalling. Neuropathic hurting can be described as a nervus hurt that evokes many alterations to happen within the peripheral and cardinal nervous system, ensuing in a serious and unwanted disfunction in the affected country, even if it appears to be healed. It is normally characterised by allodynia and hyperalgesia. Allodynia is painful sensitiveness to non-noxious stimuli e.g. a buss on the cheek. Hyperalgesia is when more hurting is felt from a noxious stimulation due to increased sensitiveness. Primary hyperalgesia refers to C-fibre sensitisation straight on the hurt site. Secondary hyperalgesia refers to dorsal horn nerve cell sensitisation environing the hurt site. There is a phenomenon called wind up in neuropathic hurting in which relentless noxious stimulation of C-fibres can ensue in drawn-out activation of dorsal horn cells. A series of consecutive wind up episodes have been linked to triping long term potentiation ( LTP ) , therefore connexions can be made with CNS synaptic malleability and memory in cardinal sensitization and neuropathic hurting. A survey in BDNF KO mice demonstrated that by bring oning nociceptive sensory nerve nerve cells in a insistent mode ( wind up ) , activity-dependent synaptic malleability of the ventral root potency greatly decreased ( Heppenstall and Lewin, 2001 ) . Neuropathic hurting that occurs after peripheral nervus hurt depends on the hyperexcitability of nerve cells in the dorsal horn of the spinal cord. After hurt, the addition in irritability induces reorganisations of the dorsal horn nerve cells. All these alterations are jointly referred to as central sensitisation ( Campbell A ; Meyer, 2006 ) . An early effect of peripheral hurt is spinal microglial activation, which leads to BDNF release ( Tsuda et al. 2005 ) . However, mechanisms involved in central sensitisation remain ill understood and the nexus between hurting and BDNF is still equivocal. BDNF in neuropathic hurting BDNF is involved with neuropathic hurting as implicated by important alterations in the degrees of BDNF look after nerve hurt to the spinal cord ( Michael et al. , 1997 ; Cho et al. , 1998 ; Zhou et al. , 1999 ; Fukuoka et al. , 2001 ; Pezet et al. , 2002 ; Merighi et al. , 2008b ) . Stimulation of nociceptors by noxious stimulations increases TrkB phosphorylation ( ERK kinase auto-phosphorylation ) in the rat spinal dorsal horn, which correlates to an addition in BDNF release in the superficial dorsal horn ( Pezet et al. , 2002a, B ) . Additionally, additions in BDNF degrees were seen via immunohistochemistry and in situ hybridisation histochemistry in uninjured dorsal root ganglion nerve cells after L5 spinal nervus ligation. Specifically in the little and average sized nerve cells ( Ad and C fibers ) did BDNF immunoreactivity and hybridisation strength for BDNF messenger RNA rise ( Fukuoka et al. , 2001 ) . Furthermore, a partial ligation of the sciatic nervus in mice resulted in an ipsilateral, important and perennial diminution in paw backdown latency from thermic stimulations. The lesion was treated with relentless intrathecal injections of a BDNF-specific antibody, which eradicated the thermic hyperalgesia. Furthermore, neuropathic hurting was blocked on application of TrkB antibodies, tyrosine kinase inhibitors and TrkB neutralizing receptor organic structures ( Yajima et al. , 2002 ) ; these molecules signify different methods of non leting the activation of the BDNF signal transduction tract. Previously mentioned in mention to wind up , was a survey that suggested BDNF in modulating neuropathic hurting by electrophysiological experiments of ventral root potencies in p4-p7 BDNF nothing mutation mice ( Hepenstall and Lewin, 2001 ) . In has been noted that BDNF modulates chloride transporter KCC2 in the hippocampus ( Rivera et al. , 2004 ) . A similar BDNF mechanism of action has been implicated for the cardinal alterations that occur in neuropathic hurting ( Coull et al. , 2003 ) . In a spinal nervus ligation theoretical account, endogenous BDNF was sequestered by a TrkB/Fc Chimera protein that wholly censored the initiation of allodynia and thermic hyperalgesia ( Bardoni and Merighi, 2008 ) . As these are the two major indexs of neuropathic hurting, their suppression by BDNF omission can merely back up the suggestion for its engagement in the neuropathic hurting mechanism. Although the bulk of research so far has portrayed BDNF as a pro-nociceptive molecule, there is besides some grounds for the converse statement that it can besides hold anti-nociceptive or analgetic effects in neuropathic hurting ( Eaton et al. , 2002 ; Lever et al. , 2003 ) . The old surveies inform us that the function of BDNF as pro-nociceptive or anti-nociceptive in neuropathic hurting is controversial. Despite this on-going argument, it is of import to appreciate that BDNF look in the spinal cord is an highly modulated procedure in neuropathic hurting theoretical accounts. Now that BDNF look in neuropathic hurting has been established, the following issue to turn to is how limited our position of neuropathic hurting has been to purely affecting neural cells. Possibly, due to miss of research and naivete, the general premise was that BDNF must be released from the primary afferent nerve cells. This prompted surveies, which foremost did non hold with this premise, and secondly changed way of BDNF beginning to another abundant cellular component of the CNS. The purpose was to better the apprehension of cardinal mechanisms and responses to peripheral nerve hurt. In recent times, research has shifted off from the function of nerve cells in neuropathic hurting and moved towards the engagement of microglia ( Watkins et al. , 2007 ) . How neuropathic hurting is propagated and maintained by astrocytes and microglia as opposed to neural influence has been of treatment in the last few old ages ( DeLeo et al. , 2004 ; Scholz and Woolf, 2007 ) . There is a sufficient sum of literature available that supports microglia holding a critical function in the induction and care of neuropathic hurting ( Inoue and Tsuda. , 2006 ; Tsuda et al. , 2005 ; Salter, 2005 ; Watkins et al. , 2001 ; Watkins and Maier, 2002 ) . Microglia need to be given more recognition than functioning every bit merely immunological entities of the CNS, taking cellular dust. Recent research authenticates that microglia have other maps as of import regulators of neuro-immune signalling, pull offing neural irritability and being a portion of the cause for the pathology of neuropathic hu rting. The deductions for the engagement of spinal cord microglia in the mechanisms of neuropathic hurting are due to the fact that microglia are widely expressed in dorsal horn synapses, they respond to neuromodulators ( e.g. ATP ) and express receptors for pain-related neurotransmitters ( e.g. P2X4 receptors ) . Current grounds for microglial-derived BDNF Experiments have been conducted that involve the targeting of siRNA against BDNF as a intervention applied to cultured microglia. The microglia were so stimulated with ATP, a molecule that is normally released after neuropathic abuse, so these activated microglia were intrathecally injected into naive rats. Administration of ATP-activated microglia, along with peripheral nervus hurt and intrathecal application of BDNF has been seen to permeate mechanical allodynia ( Coull et al. , 2005 ) . Above are three signifiers of barricading the microglial-neuronal hurting tract in vivo. Whether the beginning of BDNF is exogenic or endogenous, its application provokes a alteration in anion concentrations, chiefly chloride ions in the superficial lamina I nerve cells. The GABA receptor is activated and depolarises due to the anion reversal possible going progressively positive, this consequences in a disinhibition of lamina I dorsal nerve cells leting transmittal of neuropathic hurting. Safely b arricading the microglial-neuronal tract could be a clinical intervention of neuropathic hurting. The receptors expressed on microglia are ionotropic and metabotropic purinoceptors ( Tsuda, 2003 ; Bianco et al. , 2005 ) . Their activation is via the binding of ATP to P2X4 receptor in microglia ( Suzuki et al. , 2004 ) ; this stimulates p38 MAPK-dependent BDNF synthesis and release. The consequence is seen in the superficial spinal dorsal horn nerve cells, in which GABA suppression is reversed to GABA excitement ( Coull et al. , 2005 ) . Spinal nervus ligation, compaction and transection carnal theoretical accounts of neuropathic hurting have expressed this stimulatory response of spinal microglia ( Beggs and Salter, 2007 ) . There is grounds that suggests ATP-release occurs station nervus injury from cardinal terminuss of nociceptive sensory nerves on to the spinal dorsal horn ( Bardoni et al. , 1997 ) . ATP has been implicated to modulate both neural and damage-induced microglial activation. The communications from primary sensory nerves to microglia to secondary sensory nerve n erve cell in spinal dorsal horn are described as bi-directional, to a great extent trusting on purinergic signalling ( Di Virgilio, 2006 ) . Many surveies have shown ATP-release from nerve cells to straight modulate the operation of microglia and excite the release of immunological and neurotrophic factors, impacting the neural map ( Inoue and Tsuda, 2006 ; Tsuda et al. , 2005 ; Watkins et al. , 2001 ; DeLeo and Yezierski, 2001 ) . Zhao et Al, . ( 2006 ) stated that nociceptor derived BDNF regulates acute and inflammatory hurting, but non neuropathic hurting. They came to this decision by utilizing a peculiar technique called Cre-loxP to bring forth conditional mouse knock outs, which lacked the BDNF cistron in most nociceptive centripetal nerve cells. They were able to make this by turn uping a Na channel ( Nav1.8 ) that was specific to nociceptive primary centripetal nerve cells ; this meant that the desired BDNF cistron knock out could be restricted to this particular cell type. They used loxP sites to harbor the Nav1.8-specific BDNF cistron and so expressed Cre recombinase in these mice. As mentioned earlier, BDNF has a important function in normal nervous development so a planetary knock out is likely to hold damaging effects hence the beauty of this technique is its specificity. Therefore, the Cre-loxP method provides a safer path for happening out what happens to the behavioral and histological features of the mice when a specific cistron is non present, without interfering with its normal development. The system will be explained in more item at a ulterior point. Conditional BDNF void mice were healthy and depicted no loss of centripetal map as there is grounds demoing a typical distribution of neurofilaments, peripherinpositive nerve cells and dorsal root ganglion nerve cells in wild-type and void littermates ( Heppenstall and Lewin, 2001 ) . However, the knock out effects surfaced in pain-related behavior, instantly proposing a pain-related function for BDNF in primary sensory nerves. In BDNF void mutations, statistical analysis showed that they had a heightened sensitiveness to the stimulations so the wild-type control group ( P lt ; 0.001 ) . In drumhead, baseline thermic thresholds and carrageenan-induced thermic hyperalgesia was markedly reduced, formalin-induced hurting behavior was attenuated in the 2nd stage, which correlated with abolishment of NMDA receptor NR1 Ser896 /897 phosphorylation and ERK 1 and ERK 2 activation in the dorsal horn. NGF-induced thermic hyperalgesia was halved, and mechanical secondary hyperalgesia caused by NGF was eliminated. The above consequences are consistent with BDNF derived from nociceptive nerve cells holding a modulatory consequence in ague hurting and inflammatory hurting. Conversely, neuropathic pain behavior was non inhibited ; this suggested that either BDNF is non present in neuropathic hurting or more likely that it is derived from another cellular, cardinal beginning. The research workers used the Cre-LoxP technique as BDNF has a important function in development and to wholly take the cistron would do perinatal mortality. It allowed them to make tissue specific BDNF nothing mutation mice, which eliminated the hazard of BDNF want throughout the critical growing periods. In this instance, it gives us information about possible new drug marks and a clearer position of BDNF release and besides mechanisms of BD NF action. Familial constituents of the Cre mouse have small or no influence on pain-related behavior ( Stirling et al. , 2005 ) . Zhao et al. , suggest that by selectively taking BDNF from nociceptive centripetal nerve cells, nociceptor-derived BDNF plays an of import function in modulating inflammatory hurting thresholds and secondary hyperalgesia, but BDNF released merely from nociceptors plays no function in the development of neuropathic hurting. Hypothesis The informations so far suggests that BDNF is non released from centripetal nociceptors, but still is a critical component in neuropathic hurting. I hypothesise that microglial-derived BDNF regulates neuropathic hurting. This hypothesis can be tested by using a similar theory behind the Cre-loxP methodological analysis that Zhao et Al. ( 2006 ) used. The thought would be to strike hard out BDNF in microglia and see if neuropathic hurting is transmitted. If neuropathic hurting is mostly inhibited so this would supply grounds that microglial-derived BDNF is an of import factor of neuropathic nervus transmittal. Research OBJECTIVES Knock out BDNF from microglia. Use Cre-loxP technique to formalize recent research and possibly to see if there are clinical chances due to the high specificity of this technique. Test pain-related behavior to supply grounds that microglial-derived BDNF regulates neuropathic hurting. This would bespeak that by down-regulating BDNF in microglia, neuropathic hurting could be well inhibited. Plan of work There are surveies that have already provided grounds for the cogency of this hypothesis, every bit good as specific mechanisms of microglial-neuronal BDNF activity. However, a fresh method of consolidating this information would be to cancel BDNF in the microglia. The survey I propose is to confirm that microglial-derived BDNF is responsible for neuropathic hurting by utilizing the Cre-loxP technique to cancel BDNF cistron in microglia. The clinical relevancy of this survey would be to selectively and straight aim microglia to hold synthesis and/or release of BDNF. This would understate and possibly greatly extinguish neuropathic hurting symptoms. The clinical disadvantages of neuropathic hurting: Poor health-related quality of life for patients Large ingestion of resources and costs for the health care system Lack of specific drug interventions Weak response to normal hurting medicine Complex status Cre-loxP system It is a sophisticated, yet simple familial tool for tissue-specific omission of a cistron. The cre cistron is abbreviated from cyclization recombination, which encodes a site-specific DNA recombinase named Cre recombinase. Cre recombinase is a 38 kDa enzyme arising from bacteriophage P1. It recognises loxP sites and in return recombines them, hence catalytically removes the cistron encapsulated between two loxP sites. The bacteriophage it was ab initio discovered in uses Cre-loxP engineering for reproduction, by circularisation and helping reproduction of its genomic DNA. A LoxP site consists of a 13 bp inverted repetition, followed by an 8bp asymmetric spacer part where recombination occurs, so another 13 bp inverted repetition. Cre recombinase recognises the upside-down repetition parts. Cre recombinase showing mice strain and loxP showing mice strains are developed individually and crossed to bring forth a Cre-lox strain ( Nagy, 2000 ) . Here are some Cre-loxP strains that have been developed: Cre showing strains incorporating a transgene ( cre ) that expresses Cre recombinase, controlled by a tissue-specific booster. Inducible Cre strains incorporating a transgene that expresses a non-functional signifier of Cre recombinase that is activated upon debut of an inducement agent ( such as Vibramycin, Achromycin, RU486, or estrogen antagonist ) at a coveted clip point in embryologic development or grownup life. LoxP-flanked ( floxed ) strains incorporating a critical portion of the mark cistron for omission ( promoter sequence ) sandwiched between two loxP sites. Importantly, the Cre-loxP system is often used in mammalian systems, where tissue specific boosters allow spacial and temporal ordinance of Cre-mediated recombination [ 9 ] A. Nagy, Cre recombinase: the cosmopolitan reagent for genome tailoring, Genesis 26 ( 2000 ) , pp. 99-109. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus ( 399 ) ( Nagy, 2000 ) . Experimental method utilizing microglial-specific CD11b 1 ) Coevals of CD11b-specific BDNF knock-out mice Transgenic mice incorporating the BDNF cistron surrounded by loxP sites would be mated with transgenic mice that have the cre cistron expressed in microglia merely. The resulting mice would hold the cre cistron and the loxP-flanked BDNF cistron. Wild type/normal/ homozygous = Tissues without cre cistron, express BDNF usually. KO/null/mutant/ heterozygous = Microglia will hold cre cistron, hence express Cre recombinase ; the BDNF cistron will be deleted. A booster sequence of a protein that is specific to microglia will be required for the targeted action of Cre-lox engineering. The two cardinal microglial-specific markers are CD11b and IBA-1 ( Cunha and Dias, 2009 ) . CD11b is a cell surface receptor/antigen activated in the immunological response. This type I transmembrane protein is found on monocytes, macrophages, granulocytes, some B cells, dendritic cells and natural slayer cells that facilitate cell adhesion, chemotaxis and/or phagocytosis. CD11b is frequently used as a marker of activated microglia in nervous tissue ( Oliveira et al. , 2005 ) . IBA-1 is a microglial-specific ionised calcium-binding adapter protein, besides known as allograft inflammatory factor-1, AIF-1 ( Ahmed et al. , 2007 ) . Consequences from the same survey indicate that IBA-1 is a strong marker for microglia that can be used in routinely processed mammalian tissue. Upon microglial activation, look of IBA-1 is up-regulated, this allows the favoritism bet ween resting and activated microglia. IBA-1 has been shown to co-localize with F-actin and to be indispensable for membrane rippling in response to macrophage colony-stimulating factor and phagocytosis in civilized cells ( Ohsawa et al. 2000 ) . Most immunohistochemical surveies using IBA-1 have been in non-human mammals ( Ito et al. 1998, 2001 ; Okere and Kaba 2000 ; Hirayama et Al. 2001 ) . However, a little figure of surveies have reported IBA-1 as a microglial marker in human tissue ( Ohyu et al. 1999 ) . I will farther detail the CD11b method. The cryptography sequence for the Cre recombinase cistron ( 1377 bp ) could be amplified by polymerase concatenation reaction ( PCR ) . Including the accession figure, the Cre-specific forward primer OYY21 ( 5- GGCAGTAAAAACTATCCAGC -3 ) and change by reversal primer OYY23 ( 5- TCCGGTATTGAAACTCCAGC -3 ) could be used ( Zhang et al. , 2005 ) . The Cre recombinase PCR merchandise would so be digested and cloned in the BamHI site of the D1790 vector ( Dziennis et al. , 1995 ) , downstream of the 1.7 kb-specific CD11b booster that includes transcription start site and 83 bp of 5UTR. The noncoding DNAs and polyA sequences from the human hGH ( 2154 bp ) would be included for efficient transgene look ( Ferron and Vacher, 2005 ) . The above, linearized Notl/HindIII 5235 bp transgene fragment would be injected into fertilized mouse oocytes isolated from a common inbred mouse strain and transferred to pseudopregnant females. These CD11b-Cre mice would so be crossed with a 2nd strain of mice where the BDNF cistron is flanked by Lox-P sites. This will bring forth a mouse strain with BDNF cistron omission in microglia merely. The survey population will incorporate mice with the floxed BDNF cistron and one transcript of the CD11b allelomorph ( heterozygotes ) , and the floxed BDNF littermates ( homozygotes ) will be used as controls. Alternatively, an inactive signifier of Cre recombinase could be used, so that initiation of the dual transgenic lines can be controlled through disposal of an exogenic agent. This would let microglial specific smasher of the BDNF cistron at a specific clip i.

The Concept Of Poverty Research Paper Example

The Concept Of Poverty Research Paper Example The Concept Of Poverty Paper The Concept Of Poverty Paper The term ‘poverty’ has become very common in this world today. In fact, it has been a part of the everyday language of most people. But despite the common use of this word, it concept of essence has not been grasp fully or in totality by the majority. Because of this, they are misled to what really is centered on the concept of poverty. For the many, poverty would be defined as just the absence or lack or material possessions. To other, the lack of money can be equated to poverty. On a deeper sense, poverty can be defined as the deprivation of an individual on the three basic needs for survival- food, clothing and housing. All of these definitions are deemed correct. However, the concept of poverty has come a long way. Poverty today goes beyond the lack of material possessions or the deprivation of the three basic needs of a human being. For all we know, the concept of poverty may have developed to become a subjective term. The ‘Copenhagen Declaration’ of the United Nations defines poverty as â€Å"a condition characterized by severe deprivation of basic human needs, including food, safe drinking water, sanitation facilities, health, shelter, education and information. † With this, people can be considered as poor when they are unable to eat, have access to hospital care or even go to school regardless of their income. (ThinkQuest, 2006) With this, one can say that there are different measures utilized in order to determine the state of poverty of a person. Some would employ quantitative means in order to measure poverty while other would rely on the qualitative aspect. More so, some people would emphasize the importance of the two approaches, thus the combination of it would yield the best result. The World Bank and the International Monetary Fund (Anup, 2006), have come up with a definition of poverty line to mean one dollar per day. However, this measure has been criticized by many because it can not really provide a true picture of global poverty. This is evident in the issues of poverty threshold. For instance, in the family of four in the United States, they live with eleven dollars a day in order to survive. As such, this measure of poverty is deemed not effective since it misses out much of humanity to understand the impacts. According to the U. S. Census Bureau (2007), poverty is defined at the family level and not at the household level. As such, the household can be considered as poor when the householder’s family has a total income which is below the appropriate poverty threshold. Meanwhile, there are also different criteria in determining poverty threshold. This includes the number of children, the size of the family, age and many more. In the United States, it has been claimed that in spite of the steady decline of poverty in the country, there is still a higher rate of poverty today than before. In 1998, the Census Bureau states that there are 34. 5 million Americans who are poor. Although this rate is considered as relatively low, because of the continuous decline, it is still generally higher when compared in the 1970s wherein it ranged from 11 to 12. 6 percent. Furthermore, the characteristic of poverty is America is far from uniform. Particularly, the poverty in the country varies by age, region, family composition and race. (Almanac of Policy Issues, 2007) And so, with the significant presence of poverty in the United States, there is a need for the relatively wealthy family to help the poor. More importantly, the leaders of the country are expected to devise policies which can alleviate poverty and as well as promote sustainable development for the long-term welfare of the poor.

Healing by Heart Essay Example | Topics and Well Written Essays - 2500 words

Healing by Heart - Essay Example Like many Asian communities, herbal medicine is still very important, and many of the Hmong people prefer traditional medicines to the conventional options. This can cause conflict between those working in the American healthcare industry and the patients who wish to retain their traditions, not least because traditional medicine could cause problems that would lead to healthcare providers breaking the Hippocratic Oath. Healing by Heart: Clinical and Ethical Case Stories of Hmong Families and Western Providers gives details of the issues facing both healthcare providers and the Hmong patients in society and how these may be explained and discussed from a clinical and ethical perspective. Young Woman with Kidney Failure and Transplant The story of Mai Neng Moua is an excellent example of how the Hmong people struggle to come to terms with aspects of the American healthcare system. Moua suffered from end-stage kidney disease and thus was forced to deal with the consequences of this deb ilitating illness at a very young age. Moua was forced to wait for a kidney transplant for a long time as her family refused to get tested to see if they were a match; her mother suggesting that it was better to have one person sick than two. Moua also struggled with explaining her choice to use dialysis (an example of conventional medicine) rather than the traditional Hmong remedies for her condition to her family and friends, as this was seen as breaking with traditional culture. It is clear from Moua’s writing that she suffered greatly from the consequences of her end-stage renal failure and her choice of conventional medicine was a sensible one; it is quite likely she would have died without it. Her choice to undergo a transplant was not supported by her family, although the decision was supported by her church. One of the most interesting things about this case is that Moua’s final kidney donor was a Caucasian friend, rather than any member of her community. This could be considered an example of direct diffusion as her choice reflects an adoption of the American culture she was interacting with. Moua also notes that her choice to accept the donation of a kidney from a Caucasian friend surprised the Hmong community, and helped break down some of the stereotypes of white people, because it showed generosity. It could also be seen as an example of ethnocide, particularly from the perspective of the Hmong people, as it is an example of how American culture has perhaps predominated over the traditional, particularly amongst the younger generations. Reflections The case of Mai Neng Moua is interesting from a medical anthropology perspective because it shows how traditional medicine and conventional medicine can often be at odds. It also illustrates how members of the community can ostracize those who choose the American health system over their own culture, as shown by the fact that Moua describes herself as a ‘loss to the family, to societ y in general’. Her mother seems to be the character in this story that is most confused and hurt by Moua’s decision to undergo dialysis and the eventual transplant, and is also against many other Western ideas that Moua has, such as moving in with her college roommate. Again, this shows how those among the Hmong communities in the United States may feel that their culture is being lost or destroyed (ethnocide) or becoming amalgamated into the American cult

Book Report on Playing the Enemy by John Carlin Essay

Book Report on Playing the Enemy by John Carlin - Essay Example Uniting the blacks and whites in South Africa was considered a lost cause by many people, because the divide did not only center on colour, but culture as well. The whites had a more Western-influenced culture than the blacks who clearly embraced their traditional African roots. This was the challenge that Nelson Mandela, a black South African president faced. But he, being a man who rarely gave up, knew that if there was a God in heaven, then there was hope for unity, no matter how tall the obstacle is. With this, he took upon himself to find a way to unite the two camps of humanity that shared the same land. For he too believed that, as long as we both live in the same land, â€Å"your freedom and mine cannot be separated† (Carlin, 2008, 23). The book reveals that Nelson Mandela decided to make his move in a rugby game because rugby was one of the favourite recreational sports for the white South Africans. It was a sport the blacks did not take much part in, for they deemed it a white-man’s game. But despite this, there is some influence that sports can exert to people. It has the ability to make friends out of enemies, because it helps them come together to cheer for a common interest. Carlin (2008, Page 163) showed belief in the power of sport when he mentioned Mandela’s statement, â€Å"let us use sport for the purpose of nation-building and promoting all the ideas which we think will lead to peace and stability in our country†. The team in focus were the Springboks, the then national rugby team of South Africa. A significant number of people can be found who believe that, that team was one of the best rugby teams the nation ever had. But though it represented the nation, it was entirely composed of white men, and as expected, the audience was mostly whites. Strangely, Mandela saw this as a ripe field to promote his agenda. But this was no walk in the park for the great man. He would have to gather all the charm and charisma he had amassed during his 50 years of activism, and his strategy demanded a cause all South Africans could support. His strategy was pure genius. He agreed to host the 1995 rugby world cup games in South Africa. In addition to this he endeavoured to inspire the black South Africans to develop an interest for the sport. Although not fully successful in this endeavour, he managed to get enough blacks onto his bandwagon to ensure that his plan would work out smoothly. For the Springboks, they were facing one of the giants of the sport, the gargantuan New Zealand All Blacks, a team whose unparalleled success and discipline spoke for itself. This was no easy game for the Springboks and they knew it very well. Their chances of winning were small, but greater still, their chances of winning the hearts of their black countrymen were much smaller. Carlin specified some prominent men that contributed in making that day eventful. The first individual is Francois Pienaar the six foot Captain of th e Springboks. The other one is, Linga Moonsamy, Mandela’s top bodyguard on that day. Other prominent figures are, Niel Barnard, who was once the head of the intelligence services during the apartheid-era, and Justice Bekebeke a man that had spent a significant amount of time under death sentence for committing murder, and Desmond Tutu who is revealed

History of Berlin From a Science, Arts, and Culture Perspective Berlin Research Paper

History of Berlin From a Science, Arts, and Culture Perspective Berlin and Berlin Wall - Research Paper Example For example, the Max Planck Institute for the History of Science, which is an international and interdisciplinary research institute, offers opportunities for cultural and scientific research. Indeed, Berlin City has a wide history of technology, science, and scientists. In fact, some of the great scientists in the world hail from Berlin. Albert Einstein, Alexander von Humboldt, Otto Hahn, Max Planck, Robert Koch lived, worked and carried out their research in Berlin. Most significantly, their findings and innovations had a world impact that runs from one generation to another. Born in 1769 in Berlin, Alexander von Humboldt  is one of the most celebrated  scientists in Berlin. Alexander von Humboldt  had a particular interest in scientific research on geography and propagation of plants. As such, he conducted various studies and experiments in the fields of physics, biology, chemistry, geology, and botany. He actually drew significant results where today, over 1,000 plants, ani mals, mountains, rivers and products carry his name. Additionally, Einstein, a physicist, invented the General Theory of Relativity and the discovery of the law of the photoelectric effect that gave him Nobel Prize â€Å"for his services to Theoretical Physics in 1921. His contributions formed the basis for modern electricity bringing Berlin into the world map in matters of science. Born in 1936, Gerhard Ertl won the Nobel Prize in chemistry for his â€Å"studies of chemical processes on solid surfaces in 2007. He equally established the surface chemistry in Germany and his contribution to chemistry form the basis of chemical reactions (Berlin Tourismus & Kongress GmbH Web). Another scientist from Berlin, Otto Hahn, and Lise Meitner started a research on the irradiation of uranium with neutrons. Together with Fritz Stra?mann, they succeeded in the first atom splitting in 1938. Indeed, in 1944, he won the Nobel Prize in chemistry for â€Å"his discovery of the fission of heavy (ur anium) nuclei as basis for the use of the nuclear energy†. His discovery was significant in the creation of nuclear bombs (Berlin Tourismus & Kongress GmbH Web). Actually, Germany has the world’s largest neutron user community. We also have the Berlin Academy of Science that was founded in 1712 and the Academy of the Arts founded in 1696. To date, Berlin City has seven universities of applied sciences and more than 60 other institutions making it a 'capital of science' rich in academic life. We also have the Berlin Adlershof, which is a lighthouse scientific project, combining closely-connected exchanges of scientific ideas and cooperative agreements. Through scientific inventions, a turbine engine that could generate power for mills was introduced in Berlin. Moreover, in 1877, Furbish established the first chemical pulp mill in Berlin, Forest Fiber Co.  Equally, Berlin was the first federal State to have electric lights, the power for which was generated by the hydro electric power station from the Furbish Forest Fiber Mill (Bornstein Web). Today, Berlin has a highly complex transport subject to its diverse scientific innovations. In Berlin, numerous non-university institutes play a central role in the area of optical

Child Friendly School Policies

Child Friendly School Policies The purpose of this essay is to explore what Child Friendly School policies could learn from Comparative and International Research. Reference to CFSs in Kenya will be made with emphasis on the background of CFSs, current practices and emerging critics, success stories, problems and pitfalls and what CIR can do to subjugate some of these challenges. I will start by examining the rationale for exploring CFSs, based on literature and my professional experience. Following this background will be literature surrounding the concepts of CIR and CFSs in relation to global agendas, exploring how CFSs came into existence and the driving forces behind it. I then go on to focus on a case study of CFS in Kenya, discussing the role of CIR in the Kenyas CFS, arguing that CIR is used as a political tool in creating educational policy, rather than a research method or an intellectual inquiry. I will further critically analyze challenges facing CFSs and how knowledge on CIR can contribute more effect ively to successful implementation of CFS policies. A conclusion based on the literature and authors experience will then be drawn. Throughout the essay, I build a case in favour of CIR arguing that CIR stimulates critical reflections about our educational systems by investigating commonalities and differences across national borders. Background and Rationale Comparative and international education is one of the main fields of education with many benefits, judged by the volume of studies reported in the literature. Central to this is that many countries around the world have formulated some of their educational policies based on knowledge and research from CIR. With the current wave of globalization, researchers and experts, especially in the field of education, are always trying to find ways of streamlining their educational policies with the global trends. According to Giddens (1990:64), globalization is the intensification of worldwide social relations which link distance localities in such a way that local happenings are shaped by events occurring many miles away and vice versa. Global forces therefore have an impact on shaping local practices at grass root levels. In order to do this tactically and critically, comparative and internal research remains cutting edge in informing people about the realities, the challenges and the possible effects of uncritical transfer of ideas. One of the key developments in education has been the prioritisation of basic education as opposed to adult education or higher education. In Africa, this would be probably because, as Oketch (2004) points out, basic education yields higher rates of returns compared to higher education. This has subsequently influenced government and non-governmental organizations to focus more on improving the quality of basic education. Child-friendly schools (CFSs) in Kenya is an example of a initiative sponsored by UNICEF with the aim of not just providing children right to education but the right to the right education. In other words, CFSs are more concerned with the quality of basic education in addition to its access. The emergence of CFSs in Kenya was catapulted by the forces of agendas 1 and 2 of Millenium Development Goals (MDGs) which emphasizes on the provision of basic education. One of the six Education For All (EFA) goals agreed by the World Education Forum (2002) concerns education q uality. The term quality in education is dynamic because of the social, political and economic context at which it is used. Milligan (2011:276) adds that quality has, thus, been placed as an integral cog in the educational development machine although how educational quality is defined is a matter of great contention. Because of differences in contexts, it is imperative that knowledge of comparative and international research be used in designing policies and pedagogy in CFSs that fit that particular context. Furthermore, with the fear that some countries may lag behind as others move forward, countries from sub-Sahara Africa are now engaging in various practices in order to achieve these educational goals, a race against the 2015 set deadline for attainment of EFA goals. As the clock ticks towards the year 2015, priority goals in education may change for post-2015 and the worry is further elevated. One of the efforts the government of Kenya is doing to improve the quality of education is by integrating CFS model into the basic education system. Two major questions arise here: First, how is CFS realistic considering myriad challenges facing the FPE policy in Kenya? Secondly, if integrating CFS model into basic education will help in improving the quality of education, what lessons can CFS policies learn from CIR? It is against this background that the purpose of this essay hinges. Literature Review In this section, I will look at the concepts of Comparative and International Research (CIR) and Child Friendly School (CFS) based on the literature and merge them with the global forces that influenced the emergence of CFS with an attempt to unveil the voices behind the introduction of CFS in Kenya. In addition, I will use an example of PRISM experience in Kenya to reinforce the understanding of the role of international bodies in promoting quality through well strategized and executed projects, arguing that lessons from PRISM experience can be used as insights to successful implementation of CFS policies. Concepts of Comparative and International Research (CIR) and Child Friendly School (CFS) CIR is a fusion of two broad areas of research: Comparative Research and International Research. To understand its full meaning, it is important we define the two areas of research separately. In his definition of comparative research, Mills et al (2006:621) argue that: Comparative research is a broad term that includes both quantitative and qualitative comparison of social entities. Social entities may be based on many lines, such as geographical or political ones in the form of cross-national or regional comparisons. A similar perception was echoed by Noah and Eckstein (1969:127), who viewed comparative education as an intersection of the social sciences, education and cross-national study [which] attempts to use cross-national data to test propositions about the relationships between education and society and between teaching practices and learning outcomes. In light of this definition, comparative research in the context of education can be defined as a study of two or more entities or events (Crossley Watson, 2003) with the underlying goal of searching for similarity and variance. Cross-national or regional comparisons may include comparing educational policies, pedagogy, educational leadership and so on. According to Mills et al (2006: 621), the search for variance places more emphasis on context and difference in order to understand specificities. International education, on the other hand, can be defined as the application of descriptions, analyses and insights learned in one or more nations to the problems of developing educational systems and institutions in other countries (Wilson 2000a: 116). Therefore, international research is concerned with research carried out across two or more countries, often with the purpose of comparing responses between them. This might be done in order to devise strategies that work well across both or all these cultures or to suggest local adjustments to a global strategy There is a close relationship between comparative and international education. Epstein (1994: 918) points out, that international educators use findings derived from comparative education to understand better the processes they examine, and thus, to enhance their ability to make policy. We can therefore draw from the above two definitions that CIR in education as a method of comparing both qualitative and quantitative entities in education across different countries, societies or cultures with the aim of identifying similarities and differences. It is however important to note that not all international research is comparative, and not all comparative research is international or cross-national. According to UNICEF (2007), a child-friendly school is both a child seeking school and a child-centred school: It is child seeking because it actively identifying excluded children to get them enrolled in school. It is a child-centred school because it acts in the best interests of the child leading to the realization of the childs full potential, is concerned about the whole child: her health, nutritional status, and well-being and concerned about what happens to children before they enter school and after they leave school. A CFS system recognizes and respects childrens right and responsibilities; it provides the enabling environment to realize childrens right not only in schools, but also in childrens home and their communities. These include children from conflict zones, street children and children with disabilities. According to UNICEF Global Education Strategy (2007) the Child-Friendly Schools model (see fig 1) is based on simple, rights-based concepts as described in Table 1. Concept of CFS Description Rights Based School CFS proactively seeks out-of-school children and encourages them to enrol, irrespective of gender, race, ability, social status, etc. Gender Sensitive School CFS promotes equality and equity in enrolment and achievement among girls and boys. Safe and Protective School CFS ensures that all children can learn in a safe and inclusive environment. Community Engaged School CFS encourages partnership among schools, communities, parents and children in all aspects of the education process. Academically Effective School CFS provides children with relevant knowledge and skills for surviving and thriving in life. Health Promoting School CFS promotes the physical and emotional health of children by meeting key nutritional and health care needs within schools. Table 1: Description of a CFS Fig 1: Model of the Child-Friendly School Source: UNICEF, Global Education Strategy (2007:1) The CFS model provides a framework for planning (and monitoring the effectiveness of) strategies for increasing access to quality basic education with the specific focus on the development of strategies to include those children hitherto excluded from education (UNICEF, Global Education Strategy, 2007). It is important to note that CFS model is not a one-size-fits-all model. The model may differ from country to country depending on the context. International and Local Pressures and their influences to formation of CFS in Kenya Education in sub-Sahara Africa, and indeed in Kenya, is crafted from both influences by global trends in education and the legacies of colonialism. Chisholm and Leyenderker (2008) observe that: Since 1990, the goals and purpose of education in sub-Sahara Africa has been reshaped by four interconnected developments: globalisation, the changed focus of international aid agencies towards development assistance, the adaptation of sub-Sahara African countries to the new world order with its new political emphases, and the spilling over of new pedagogical ideas from the USA and Europe into sub-Sahara Africa. (p 198) Kenya is a signatory to a number of conventions in education, including the Convention to the Rights of the Child (1989), the World Declaration on Education for All (Jomtien, 1990), the Dakar accord and the Millenium Development Goals (2000). In achievement of education development goals, Kenya is bound to, among other things, quality education by MDGs. The Jomtien call for access for access, equity, quality and democracy in education appeared to promise both social and economic development (Chisholm and Leyenderker, 2008). Social and economic development, and continues to be believed, requires educational change and educational change is necessary for social and economic development (ibid:). Educational change, in turn, is perceived to depend on, amongst other things, the input from relevant development assistance projects. These projects, in the arena of education, are typically formulated with reference to internationally negotiated development agendas (like the MDGs) and priority (Crossley Watson, 2003). An example of these projects in Kenya is CFSs which are supported by United Nations Childrens Fund (UNICEF). The Education Section of UNICEFs Programme Division introduced the Child Friendly Schools (CFS) framework for schools that serve the whole child in 1999 (Chabbott, 2004). Rationale for introducing CFS framework in Kenya The increased reliance of foreign aid to support education reform in Kenya has been accompanied by a transition, from understanding education as a human right and the general good to viewing it primarily in terms of its contribution to national growth and well-being through the development of the knowledge and skills societies are deemed to need (Arnove Torres 2007:359). Occasional voices continue insisting that education is liberating, that learning is inherently developmental (ibid: 359). With the global concern that Sub-sahara Africa countries may not achieve Universal Primary Education (UPE) by 2015 unless the progress is accelerated (Carceles et al., 2001; Bennel, 2002), Kenya responded by introducing Free Primary Education (FPE) policy in 2003 with both local and global pressure. The rationale behind introducing FPE was (apart from the pressure from global and international agendas) to alleviate poverty attributed to lack of literacy skills. The success story behind implementation of FPE policy is increased enrolment at primary school level by approximately 50% from 5.9 million in 2003 to 9.38 million pupils according to the Kenya Economic Survey 2011. However, there are myriad challenges facing the implementation of FPE policy which include high teacher-pupil ratio, inadequate infrastructure, overcrowded classroom, inadequate textbooks and many schools lacking sanitation facilities. All of these challenges militate against the provision of quality teaching. There is no magic wand for fixing this problem of quality in education. In response to this CFS were introduced in Kenya. According to UNICEF Child-friendly Schools Manual (2006:1): The challenge in education is not simply to get children into school, but also to improve the overall quality of schooling and address threats to participation. If both quality and access are tackled, children who are enrolled in primary school are likely to continue, complete the full cycle, and achieve expected learning outcomes and successfully transition to secondary school. The CFS framework (see appendix 3) aims at promoting child-seeking, child-centred, gender-sensitive, inclusive, community-involved, protective and healthy approaches to schooling and out-of-school education with a general goal of improving the quality of learning. Since CFSs are concerned with the quality of learning, it is important we look at the meaning of quality. The national examinations to obtain the Kenya Certificate of Primary Education (KCPE) at the end of primary cycle and the Kenya Certificate of Secondary Education (KCSE) at the end of secondary cycle are designed to evaluate the extent to which the primary and secondary graduates master the curriculum content. In other words, the national test scores are used as the indicators of quality. The limitation of this indicator is that it does not take into account the context at which learning takes place i.e. the learning environment, learners unique characteristics etc. There are many definitions of quality but one of the descriptions of quality which emphasizes on the context was by Tikly (2011:10) who argued that: A good quality education is one that enables all learners to realise the capabilities they require to become economically productive, develop sustainable livelihoods, contribute to peaceful and democratic societies and enhance wellbeing. The learning outcomes that are required vary according to context but at the end of the basic education cycle must include threshold levels of literacy and numeracy and life skills including awareness and prevention of disease. In his description, Tikly believes that a good quality education arises from interactions between three overlapping environments, namely the policy, the school and the home/community environments. In his perception of quality education, Tikly puts context into consideration i.e. needs of the learner, cultural and political contexts. In addition, he emphasizes on the relevance of what is taught and learned and how it fits the nature of particular learners in question. This encourages policy makers to take cognisance of changing national development needs, the kinds of schools that different learners attend and the forms of educational disadvantage faced by different groups of learners when considering policy options'(ibid:11). The fact that CFS emphasizes on learner-centered pedagogy and puts the child at the centre or focal point in the learning process raises the idea of what is regarded as valuable knowledge and how this knowledge is acquired in this particular context. This leads us to the inquiry on the school of thought or paradigm behind introducing a contextualized CFS framework. CFS as an approach to education is premised on constructivism, a theory of knowledge arguing that humans generate knowledge and meaning from interaction between ideas and real experiences. According to constructivists, the notions of reality and truth are socially constructed and in different context with the understanding that knowledge is subjective and embedded in multiple realities. Thus, quality of learning should be viewed in the context in which it is occurs. Towards Quality Basic Education In Kenya: Developing Research Capacity and Evaluation Before we acknowledge the contribution of CFS in providing quality education to the children at Primary school level, it will be prudent to review some of other contributions that has been made by international organizations in collaborations with the local government in promoting quality of education at grassroot levels in building research capacity. Kenya has had a history of benefiting from international assistance in its education sector. One of the programmes is the Primary Schools Management (PRISM), an initiative of DfID through the Ministry of Education, which places a lot of emphasis on participatory approaches and emphasis on mobilising community support, resource management and utilisation, supporting learning of pupils and developing action plans. It targeted teacher training and management and the impact of this is overall effectiveness of an education system which has a direct bearing on quality of education. According to Otieno Colclough (2009:26), PRISM is regarded as one of donor-funded programmes which had most positive impact on quality of basic education and CFS can learn from it. As Crossley et al (2005) note, the main objective of PRISM was to improve the quality of primary education through the training and support of head teachers in practical management skills. Borrowing from the PRISM experience it is wo rthy learning that well planned and organized CFSs policies involving community participation at grass root level could help amplify local voices and lead to successful implementation of educational policies not only in Kenya but also other parts of African contexts. Challenges in implementing CFS in Kenya In this section I will explore common challenges associated with the CFSs with an aim of illuminating and critiquing the gap between policy and practice in CFSs. Access and Quality Dilemma: Which one should be first priority? As I mentioned earlier, one of the role of CFS in Kenya is to improve the quality of learning. But the access to education is still a challenge in Kenya and there is fear that Kenya will not have achieved EFA goals 1 and 2 by the year 2015. Many comparative researchers argue that different countries have different educational problems and it is the countrys obligation to identify what should be the priority and why. Aksoy (2008: 218) observes that: While developed countries are mainly engaged in activities to increase the quality of education, or they practice and seek new techniques and methods of learning and teaching, developing countries struggle to provide equal opportunities for education, trying to increase the rate of participation of all citizens in basic education, which is actually compulsory. To deal with its educational problems, each country works out countrywide or local solutions, depending on the nature of the problem. The tone of such statement is more closely allied to the question of priority. Priority in one country may not be a priority in another. In Kenya, the major problem basic education is facing is of access while higher education is facing the problem of quality. CFS focus more on quality, but in the Kenyan context, access to education is still a problem in basic education even after the introduction of FPE. The CFS concept of quality can however suit very well in some small state commonwealth countries which have almost universal access to basic education. It has been noted that small sates have now shifted education priorities towards focus in school effectiveness, quality and inclusion (Crossley, 2002) after ensuring that all children have accessed basic education and CFSs in Kenya should learn from small states that the priority should now be on access to basic education before shifting to quality. Atomizing the child: is child-centred the solution to quality CFS? A key feature of a right-based, CFS system is that it is linked tightly to the child-centred learning process. CFS advocates for child-centred learning where a child is treated as a single entity or an atom in learning processes. The idea of atomizing a child has its drawbacks derived from child-centred learning. First, there is an oversight on early year development behaviour of the child. Psychologists believe children undergo various levels of development and their learning behaviours are different at each level. For instant, Vygotskys (1978) concept of the zone of proximal development (ZPD) implies that a child cannot ordinary create ZPD by himself; he needs the more expert individual to bridge the gap between his current development level and his proximal level of development. Secondly, a child-friendly, democratic learning environment may not work successful in overcrowded classrooms and school with limited resources like it is the case in Kenya. Thirdly, child-centred learning weakens the role of the teacher. The idea that a child must be active in construction of knowledge is often understood to imply a diminishing role for the teacher in learning process who now becomes a coach or a facilitator. A call for paradigm renovation, from an exclusively child-centred learning to a combination of both child-centred learning and teacher-centred learning approach is important so that the weakness of one method is complemented by the other method. What Lessons can Kenya learn from other Countries in Implementing CFS? A Review on the Contribution of Comparative Research King (2007) emphasizes the need to explore the tension between the national and the international policy agendas in Kenya in order to make informed decisions when crafting educational policies. Clearly, this is a view that acknowledges the contribution of CIR researchers in bridging theories, policies and practices with both local and global minds (Crossley, 2000) in trying to identify betters grounds to critically reflect and determine appropriate course of action. Apparently, the term that is commonly used in Kenya and indeed many Africa countries in the initial processes of designing an educational policy is benchmarking. Essentially, this is usually a comparative study which is carried out locally and/or internationally in trying to compare different models of policy framework with the aim of critical adaption or adoption. Lessons are well learnt when a comparisons are made, and this underscores the strength and significance of comparative research. Moreover, since problems transcend national borders, it is prudent to seek possible solutions by learning from a similar experience in another country, and this explains why international research is important. Kenya can learn from other countries that are either progressing or failing to implement CFS policies because lessons can either identify opportunities or gaps, based on comparative analysis. In these respect therefore, I have identified two key elements of CIR which could help implementat ion of CFS. The first element is on identification of the gap between policy and practice. Documenting the emerging good practices and lessons learned within the regions is useful in informing evidence based programming and advocacy to enable us to achieve better results. For example, a Global Evaluation Report published by UNICEF in 2009 on comparative studies of how to six countries (Guyana, Nicaragua, Nigeria, Philippines, South Africa, Thailand) with different experiences implementing CFS, demonstrated the following: CFSs in varying contexts successfully apply the three key principles of CFS models-inclusiveness, child-centredness and democratic participation. Schools operating in very different national contexts, with different levels of resources and serving populations with different needs have succeeded in being child-centred, promoting democratic participation, and being inclusive. Schools that had high levels of family and community participation and use of child-centred pedagogical approaches had stronger conditions for learning, that is, students felt safer, supported and engaged, and believed that the adults in the school supported the inclusion and success of each student. (UNESCO, 2009) Kenya can use this success report to assist in providing a broader perspective on the ways in which CFSs can contribute to quality in the countrys unique context. The caution should however be that any steps taken should have hindsight of the current context in the country to avoid uncritical transfer of practice which may end up opening a Pandoras box. Secondly, through CIR, studies of educational systems from countries that share similar problems or pitfalls can provide information for learning possible consequences. A recent comparative evaluation research conducted by UNESCO in Nigeria, Gunaya, Thailand and the Philippines on CFS pedagogy gave different findings. While teachers in Nigeria and Guyana mainly focused on meeting basic instructional material needs (textbooks, paper), many teachers in Thailand and the Philippines focused on having greater access to information and communication technology (UNESCO 2009). Kenya experiences the same challenge as Nigeria and Gunaya, and data from these countries can be used to learn how they coping with inadequate basic instructional material. The caution here should be, that common problems may prevail in different countries, but common model cannot be applied because every country has different culture/context (Crossley Watson, 2003: 39). This provides invaluable information of what to adopt, modify or avoid. Conclusion It is worthy reiterating Crossley'(2003) emphasis that context matters and different countries have different needs and priorities even if they are faced with the same challenges. The value of CIR is studying foreign systems of education in order to become better fitted to study and understand our own (Sadler 1900, reprinted 1964:310) and CIR can be used as a lense to focus on adaptable or adoptable practices. UNICEF repeatedly emphasises that CFS is a pathway to educational quality rather than a blueprint and that it is counterproductive to regard the CFS model as rigid, with a present number of defining characteristics or key components (2009c, Ch. 1, p. 9). Thus, the essay sought to present an overview in favour of the contribution of CIR by highlighting what CFS policies in the Kenyan context could learn from CIR. As such, the essay acknowledges the role of CIR in stimulating critical thinking and reflections about CFSs system by evaluating its success and failures, strengths and weaknesses. This critical reflection facilitates self evaluation in our own context and the basis for determining appropriate courses of action. The essay also hints that CIR helps us understand global agendas and how they shape educational development projects from organizations and development agencies.

Latino Actors and Resistance Cinema :: Movies Films

Latino Actors and Resistance Cinema During the second half of the twentieth century Latino actors began to resist the previously portrayed stereotypes in American films. "The beginning of this "coming to self"†¦was the desire to expose the terrible conditions under which Puerto Ricans of this generation had been raised; challenge the assumptions under which these conditions thrived; and re-create the institutions and society that had engendered them" (Jimenez, 188). For many years Latinos allowed themselves to be depicted under various stereotypes which they therefore represented in real life to audiences everywhere. By mid-century, Chicanos, Cubans, and Puerto Ricans began to form ways to deviate from the conventions of earlier American cinema. Documentaries were one creation that offset the false stereotypes put forth by many American filmmakers because they identified with the realism and actuality of Latino life. According to Cine-Aztlan, "in a class society, only those who control have the power to interpret the situation of the masses. That is why capitalist documentaries will never trace the source of the problem and the injustices that the world masses experience under a system of exploitation and human oppression (Cine-Aztlan, 278). When Latinos actually took the step towards self-representation and began producing and directing films and documentaries themselves, the truth started seeping through the lines. In "La Operacion", we see how the Puerto Rican government dealt with the issue of population control. The situation is portrayed realistically and the harsh truth is presented by real people who have real stories to share. This type of cinematography is directly political form of filmmaking that is more likely t o stir emotion in the audience. Luis Valdez could be labeled the originator of the resistance movement, stirring much emotion and discussion with his films. Notably, he directed Zoot Suit, a film portraying a young Chicano who must go through great difficulty to clear his name of a murder he did not commit. Joseph Vasquez directed Hangin' With the Homeboys, a movie directly addressing the stereotypes of minorities through comedy and exaggerated characteristics.