The Genius of Alexander the Great Book Review Essay

The Genius of Alexander the Great Alexander III of Macedon, widely known as Alexander the Great, is opinioned by some people to have been a ruthless man who only had a thirst for conquest , but according to others he was a man of intellect and â€Å"statesmanlike vision† (Hammond Preface). In N.G.L. Hammond’s book The Genius of Alexander the Great, as stated in the preface, he tries to refrain from writing based on his own opinion of Alexander, and instead analyzes the few surviving narratives on Alexander’s achievements in an unbiased manner. He portrays the conquests, struggles, and greatest achievements of Alexander’s career, such as the building of his empire that stretched from the eastern Mediterranean coast through Asia Minor and the†¦show more content†¦He was liked by many people due to his great gift of friendship (Hammond 5), allowing him to become admired and respected as a leader. There were many events that lead to the death of Alexander, one including the passing of his best friend Hephaestion, which caused Alexander to fast and lay in grief for two days (Hammond 196). Before he died, he believed that if he gave thanks to the gods and prayed, they would hear his thoughts and grant him salvation. Because of this, he did not arrange a transition of power (Hammond 200). However, Alexander did not have the gods on his side as much as he thought he did because on June 10th, 323 B.C.E. he died at the age of thirty-two (Hammond 198). He had obtained a fever and later lost his power of speech (Hammond 197). Soldiers came into his room and â€Å"as the men filed past he was unable to speak but greeted them with his eyes† (Hammond 198). It was suggested that he died of malaria tropica, and other reports said he died of poisoning or alcoholism (Hammond 198). Nicolas Geoffrey Lemprià ¨re Hammond, otherwise known as N.G.L. Hammond, was a professor of Greek University of Cambridge (N.G.L. Hammond: Professor†¦). He was born on November 15th, 1907 and died March 21st, 2001 (N.G.L. Hammond Bio†¦). He has written multiple books including his first book A History of Greece to 322 B.C.E., Alexander the Great: King, Commander, and Statesman and a three-volume collection titledShow MoreRelatedRacism And Incarceration Rates Among African Americans And Hispanics Essay1581 Words   |  7 Pagesthe reason, there is a need to review the history of the United States. Through the review, it is clear that the past arrest patterns is more an indicator of institutional racism still exists in this country. The New Jim Crow: Mass Incarceration in the Age of Colorblindness is a book by Michelle Alexander, who is a civil rights litigator and legal scholar. The book discusses racial issues related to African-Americans and mass incarceration in the Uni ted States. Alexander describes a set of practicesRead MoreThe Effects Of American Criminal Justice System Created By Public Perceptions Essay1565 Words   |  7 Pagespatterns is more an indicator of institutional racism that exists in this country. The New Jim Crow: Mass Incarceration in the Age of Colorblindness is a book by Michelle Alexander, a civil rights litigator and legal scholar. The book discusses race-related issues specific to African-American males and mass incarceration in the United States. Alexander describes a set of practices and social discourses that serve to maintain African American people controlled by institutions. She also argues that â€Å"TheRead MoreEssay on Alexander The Great1620 Words   |  7 Pages Few historical figures stand out in the same degree as that of Alexander the Great. He was a warrior by 16, a commander at age 18, and was crowned King of Macedon by the time he was 20 years old. He did things in his lifetime that others could only dream about. Alexander single-handedly changed the nature of the ancient world in just over a decade. There were many attributes that made Alexander â€Å"Great.† He was a brilliant strategist and an inspired leader; he led by example and was a conquerorRead MoreHarlem Renaissance: W.E.B. Du Bois.1617 Words   |  7 Pagesmagazine, he actively sought and presented the literary genius of black writers for the entire world to acknowledge and honor (Gale schools, 2004). Du Bois was born on February 23, 1868 in great Barrington Massachusetts. His father was a former civil war soldier who left the family for was when his son Do bois was still a toddler. His mother, Mary Silvina Burghardt Du Bois, died in 1884, shortly after her son graduated at the top of his class from Great Barrington High school. Although du bois had beenRead MoreThe Fallacy Of Public Education1580 Words   |  7 PagesFallacy of Public Education â€Å"Do not train a child to learn by force or harshness; but direct them to it by what amuses their minds, so that you may be better able to discover with accuracy the peculiar bent of the genius of each.† -Plato For the last several decades, there has been a great return to homeschooling. Many families have seen the need to remove their children from the public education system for a variety of reasons: for religious grounds, because of a decline of morals in the public systemRead MoreHow Has The Wearable Sculpture Of Alexander Mcqueen, Iris Van Herpen And Lucy Mcrae Influenced Contemporary Everyday Fashion2174 Words   |  9 Pages Module: ADHCOREI001AE2015/6. Date of Submission: 15/03/2016. Tutor: Katherine Wagner. Special Study Proposal: How has the wearable sculpture of Alexander McQueen, Iris Van Herpen and Lucy McRae influenced contemporary everyday fashion? Introduction: The Special Study topic I plan to construct, concentrates on the relationships between that of the art form ‘wearable sculpture’ and contemporary, everyday fashions. I will delve into each of their distinctive unique worlds and discoverRead MoreThe Red Badge Of Courage1553 Words   |  7 Pagescourage that transitions to courage that radiates. Crane rights a compelling piece that presents four central themes to the reader, that develop the main character and stick to the paradigms of the Civil War era. Crane has 4 main themes throughout his great piece of literature â€Å"The Red Badge of Courage.† Just like the title suggests one of the main themes of the novel is courage. The story is more about Henry’s conflicting ideas about courage though. Crane says â€Å"Whatever he had learned of himself wasRead MoreThe Story of My Life2883 Words   |  12 Pagesnamed John Albert Macy, who later married her first teacher and lifelong companion, Anne Sullivan. In the book Helen recounts the first twenty-two years of her life, from the events of the illness in her early childhood that left her blind and deaf through her second year at Radcliffe College. Prominent historical figures wander among the pages of The Story of My Life: She meets Alexander Graham Bell when she is only six and remains friends with him for years; she visits the acclaimed American poetRead MoreThe Epistolary Form Of Writing1926 Words   |  8 Pageswell recognised in literature and prose with many of the â€Å"Greats† of the time adopting the Epistle for their own works. Famous examples of the use of the Epistle can be found in the works of Ovid with the â€Å"Heroides†, â€Å"Trista† and â€Å"Ex Ponto† each being an individual collection of epistolary poems. An important figure in regards to the epistle is of course Horace, who published two books of epistles in 20 BCE and 14 BCE. In the first book â€Å"Epistularum liber primus† Horace includes a collection ofRead MoreThe Eras of PC Advancement1455 Words   |  6 Pagesof parallel digit plan of 0 and 1 can give to a great degree careful impacts. At any rate the issue is that they are exorbitantly direct and unequipped for broad scale numerical operation. In the cream sorts of workstations the Digital accomplices change over the straightforward signs to perform Robotics and Process control. The Mainframe Computer : These are Pcs used by immeasurable acquaintanceships like meteorological reviews and measurable foundations for performing mass numerical

Childhood Education, Delinquency, and Life - 2845 Words

Childhood Education, Delinquency, and Life If we are to teach real peace in this world, and if we are to carry on a real war against war, we shall have to begin with the children,† Mahatma Gandhi. This is very important as we look into the life of a child. The events that are put in place for a child in its early stages, can effect who they will be years to come. The years between 6 and 14—middle childhood and early adolescence—are a time of important developmental advances that establish children’s sense of identity (Eccles). During these times the children are trying to find themselves in school, and in the home, but the three things that are stunting a great childhood are; childhood deliquesce, the care taking and education in the school system, and the child’s home life. Childhood deliquesce has been around for many years, and has grown. The arrest rate of child delinquency change between 1988 and; arrests for violent crimes increased by 45 percent (United States. U.S. Department of Justice). Many times these children don’t just start causing trouble, but they have grown into role, most often young can see this at an early age, though language, temperamental characteristics, and be disconnected to the caregivers (United States. U.S. Department of Justice). These early signs can predict the child’s later actions in life. Also, signs of a delinquent are; aggressive behavior and impulse behavior. Today, there are many aids that prevent and help children from causing harmShow MoreRelatedDangerous Classes of New York Essays1074 Words   |  5 Pagesof juvenile delinquency to the considerable range of social issues the show discusses. The Wire almost flawlessly represents the factors which cause a young person to â€Å"defect†Ã¢â‚¬â€ from the failings of the city school district, a difficult home life, or the struggle of homelessness, to the surrounding environmental influences that arise from life in the city of Baltimore. However, while The Wire and its examination of causalities does many things for the discussion of Juvenile Delinquency on the whole—takingRead MoreThe Theory And Social Control Theory1106 Words   |  5 PagesHirschi Travis Hirschi is an American criminologist who is famous for developing the self-control perspective on crime and social control perspective on juvenile delinquency. In his groundbreaking work, Causes of Delinquency, he argued out that an explanation for delinquency can be achieved by absence of social bonds. He also stated that delinquency could be prevented by social attachments, acceptance of social norms, recognizing the moral validity of law and involvement in conventional activities. In hisRead MoreThe Issue Of The Juvenile Justice System Essay1539 Words   |  7 Pagesnot been so. Despite the Constitutional vision of a healthy and happy child protected against abuse and exploitation, and a National Policy for Children, the majority of children in India continue to live without a cared, protected and meaningful childhood. The juvenile justice system as conceived by legislation aims at providing care, protection, treatment, development, and rehabilitation of delinquent and neg lected juvenile. India is a signatory to UN Declaration on The Rights of the Child, 1959Read MoreThe First National Child Protection Legislation1434 Words   |  6 PagesNeslon 2013). The express purpose was to help states implement programs to deal with the problem of child abuse (Trost 1998). Through raising awareness, there are high hopes of lowering juvenile delinquency with at-risk individuals. Children who are physically abused tend to become offenders later in life (Welsh and Farrington 2007). Child abuse was not formally identified as a medical condition until 1962, when medical professionals were eventually involved and diagnosed children with the BatteredRead MoreThe Effects Of Self Regulation On Children s Behavior1497 Words   |  6 PagesEarly negative emotionality is considered a vulnerability factor for future behavior problems, including self-regulation deficits. Temperament is progressively taken under control by self-regulatory that emerges towards the end of the first year of li fe and can be reliably measured by 18 months of age. On the opposite end of things, high levels of positive affect during infancy were associated with high effortful control in toddlers. However, this relation was inversed from toddlerhood to preschoolRead MoreThe Effects Of Delinquency On Children s Life1657 Words   |  7 Pagesmore crimes than adults, and that if we can reduce the amount of delinquency that occurs in the United States, then we will also reduce the amount of crime. To understand how to prevent delinquency, we must first understand what causes it. Delinquency can be caused by a number of factors involving the child s family, socialization, economic background and drug use. Of course, the earliest contributor to delinquency in a child s life is the family. (1) Early family dysfunction can lead to emotionalRead MoreThe Youth Through Prevention And Detection, Rehabilitation, And Establishing A Future For Juvenile Justice System Essay1428 Words   |  6 Pagesfor a given individual, make it more likely that this individual, rather than someone selected from the general population, will develop a disorder† (Mrazek and Haggerty, 1994:127) As a result of studies conducted on the juveniles impacted by delinquency, it has been determined that the factors can be placed into six bulk categories: physical factors, mental factors, home conditions, school conditions, neighborhood conditions and occupational conditions. (Bridges, 1927) Physical factors are knownRead MoreIs There A Strong Relationship Between Poverty And Juvenile Delinquency?1655 Words   |  7 PagesMandy Feldbauer Is There a Strong Relationship Between Poverty and Juvenile Delinquency? There is a lot of research in the world on whether or not poverty and juvenile delinquency are correlated. Of what I’ve seen, the studies suggest that there is, in fact, a relationship between them. Poverty is a serious issue, and it not only affects the people living in poverty, but it also affects the people around poverty-ridden neighborhoods. This study will address the issue of poverty on juveniles.Read MoreSocial Outcasts and Juvenile Deliquency Essay909 Words   |  4 Pagesoutcasts as they are simply referred to may develop a low self esteem and have a low social status. Social outcast are also hated, discriminated and persecuted by the society and as a result they may result into being depressed and lonely. Juvenile Delinquency refers some illegal and antisocial behaviors by persons who are under the age of 18 thus are minors. This means behaviors that would be regarded as crime if done by an adult. Juvenile delinquent refers to those children or adolescent who behaveRead MoreJuvenile Delinquency Is A Great Issue Essay1462 Words   |  6 PagesJuvenile delinquency has become a great issue in this country. The reasons for delinquency are many, yet the fixes to the delinquency problem are few. Not enough is being done for the youth of this country to rehabilitate, deter, or change the way the youth acts. There isn’t enough communication or interaction between the key stakeholders that can help prevent juvenile delinquency. For the longest time juvenile delinquency has been increasing despite any efforts put forth by lawmakers to deter this

Analysis of the Modernist Design Style Free Essays

Modernism is appear in 20Thursdaycentury. And Modernism is including simple and no ornament design manner. Although this manner was appear early 20Thursdaycentury and have different interior decorators or designer have many spread. We will write a custom essay sample on Analysis of the Modernist Design Style or any similar topic only for you Order Now But still hold excessively small modern architecture physique in early 20Thursdaycentury. After World War II, they become many company and bureau. And do this manner be the top. Here have some designer is more celebrated. Walter Gropius, Ludwig Mies van der Rohe, Le Corbusier and Frank Lloyd Wright. Frank Lloyd Wright is one of the celebrated designer in early 20Thursdaycentury. He is a American Institute of Architects, interior interior decorator, Writer and Educators. His design undertaking is over 1000 and complete about five 100s. And he believes that design should accomplish harmoniousness between worlds and the environment. And it become Organic architecture. For illustration, Fallingwater is the celebrated on the universe. This design can turn out his thought. Besides this design is one of the best designer on the American. More than 70 old ages of his calling at Architects. He design different architecture. It including Office, Church, Skyscrapers, Hotel and Museum. Besides he design some furniture and stained glass. In his life he write over 20 book and article. And he is the celebrated talkers. In 1991, American Institute of Architects name Wright â€Å"The best Architect† . He designed different architecture. And his design was celebrated. For illustration, Robie House, Imerial Hotel, Fallingwater, Taliesin West, The Solomon R. Guggenheim Museum, Price Tower and Jonson Wax Headquarters. Besides his thought was affected many interior decorator. Person said how Wright work alteration American architecture, but person said â€Å"How did n’t Frank Lloyd Wright alteration architecture in America I think is truly the manner to state it because it is difficult to conceive of what American architecture would be like or even likely universe architecture without Frank Lloyd Wright. About the Organic architecture, he has a celebrated plant. It called Fallingwater. Fallingwater physique in 1934-1937. In 1991, members of the American institute of Architects named the house the â€Å" best all-time work of American architecture† and in 2007, it was ranked 29th on the list of Amercian’s Favorite Architecture harmonizing to the AIA. About the design, the form of the edifice expression natural, insouciant, stretch. Besides The chief room of the edifice with an out-of-door patio, platforms and roads, intertwined, besides obtained with the environing natural landscape with the consequence of merger. About the stuff, White concrete and rock Lashkar-e-Taiba this design expression merge in the environment. And this design is really particular. Because the platform is above the waterfall, this design in that clip is intensely. And this design was influence many designer. Besides it cause the new design manner. About the Taliesin West design, he thinks it has b een linked with the desert. So he utilize local rock and concrete. Besides the natural lighting is the chief function. Because he believes the natural lighting can allow inside the edifice connect to the exterior. His thought has affected some designer. For illustration Neville Gruzman, Kendrick Bangs Kellogg, Alvar Aalto, Nari Gandhi and Bruce Goff. All of them have build Organic architecture. Such as Neville Gruzman. Hills House and Gruzman House is the celebrated organic architecture. Besides Hills House is the work is thought of as a two 20Thursdaycentury houses: â€Å"Fallingwater† and â€Å"Farnsworth House† . And Gruzman House is use stuffs such as dark stained lumbers and natural brick. His designer is conform Wright method. About Bruce Goff, he said that his hero is Wright and Sullivan. Then he started to reach the original design. Bavinger House is important illustration of organic architecture. The house has no interior wall ; alternatively there are a series of platforms at different tallness, with drapes that can be drawn for privateness. The design usage many natural dark, make the inside country connect to the exterior. Kendrick Bangs Kellogg is an pioneer of organic architecture. In 1955, he met Wright and the brief meeting provided an inspiration. His design is non fit neatly into the same with Wright, Bruce Goff or other organic designers. His edifice are surveies of superimposed, segmented and unfolding infinite. And he design Onion house. It is a landmark of organic architecture. The design usage employs semitransparent curving roof panels. Since with no outside walls, the division between interior and exterior consists of screen or stained glass. But person possibly doesn’t cognize what organic designer is. So Wright explains that, it is term meant from nature, organic architecture was so a natural architecture. And now we eventually understand what organic designer is. And he believe good edifice is non one that hurts the landscape, but one which makes the landscape more beautiful than it was before the edifice was built. So he wants clean lines and simpleness. And disliked intricate item and irritability of the architectural manners. In add-on to organic designer, Wright steel has affected other designer. For illustration John S. Van Bergen. And his manner is Prairie manner places. About the Prairie manner. In 1909, Wright developed what known as the Prairie Style. Typical Prairie manner place is distinguished by horizontal lines on the outside, emphasized by a low-pitched hipped roof. But Wright use different colour, and allow the ceiling highs and hallway breadths to alternately compress and spread out the sense of infinite. His design went beyond the edifice to the finest inside informations of the interior infinite, include furniture, art glass and other interior design. And the celebrated prairie manner designer is Robie House. It was designed in 1908. Frank Lloyd Wright’s designs of place and edifice have inspired coevalss of designers, including most of what is called â€Å"modern architecture.† His influence is international—many other states have considered Frank Lloyd Wright’s designs as a major templet of their modern-day manners. More than 30 provinces in the United States possess Frank Lloyd Wright constructions and most architectural critics agree with that every province in the state has edifices that reflect Wright’s manner. Presents, when human want to develop something else, and they will destruct the natural. So they must retrieve that Wright has said the human existences and nature can conexist. And it is of import, even he is gone, but his architectural theory still affected other interior decorator. But person think he was chesty adult male. Because he want to allow his ain considerable on his clients. For illustration, Fallingwater. The design is particular and advanced. But despite there may be dangers he still carry out his out his design. I think his behaviour is right. Because if one’s creativeness is easy affected by the others, so that one is non a qualified interior decorator. Plagiarism:24 % hypertext transfer protocol: //encyclopedia.jrank.org/articles/pages/6404/Wright-Frank-Lloyd.html hypertext transfer protocol: //freshome.com/2012/09/03/10-great-architectural-lessons-from-frank-lloyd-wright/ hypertext transfer protocol: //translate.google.com.hk/translate? hl=zh-TW A ; sl=en A ; u=http: //en.wikipedia.org/wiki/Frank_Lloyd_Wright A ; prev=/search % 3Fq % 3Dfrank % 2Blloyd % 2Bwright % 2Binfluences % 2Bon % 2Barchitecture % 26sa % 3DN % 26biw % 3D1367 % 26bih % 3D840 hypertext transfer protocol: //en.wikipedia.org/wiki/Bruce_Goff hypertext transfer protocol: //en.wikipedia.org/wiki/Neville_Gruzman hypertext transfer protocol: //en.wikipedia.org/wiki/Kendrick_Bangs_Kellogg hypertext transfer protocol: //www.distinctbuild.ca/neville_gruzman_architect.php How to cite Analysis of the Modernist Design Style, Essay examples

European Union Agency for Network and Information Security

Question: Discuss about theEuropean Union Agency for Network and Information Security. Answer: Introduction Overview of Case Study ENISA stands for European Union Agency for Network and Information Security and is a centre of network and information security expertise. The case study on current threats and ENISA Technology Landscape (ETL) was published in the year 2014. This landscape was first published by ENISA and due to this reason there were a lot many impressive changes that were seen in association with the top threats that were involved. Controlled security architecture was presented along with an amalgamation of stronger law enforcement operations. However, in spite of the ETL, there were a number of occurrences of security threats and attacks. Secure Socket Layer (SSL) and Transport Layer Security (TSL) faced a lot of stress due to the demand and the requirement of the security mechanisms to be installed. There was also a massive increase in the cases of data breach and physical violations that were seen commonly. The case study covers the top threats that were seen in the year 2014 and the detailed de scription of each of the threat such as malicious codes, botnets, span, phishing, data breaches, insider threats and many others. There are a number of threat agents that are involved with all of these threats and the same have also been discussed in the report. Attack vectors and the emerging threat landscape in association with the emerging technologies such as mobile computing, cloud computing, big data and many others has also been highlighted in the case study. Internet of Things (IoT) and network virtualization are the two emerging technologies that are on a rapid rise and the landscape that is required to be designed to control the security threats associated with these concepts has also been covered in the case study of ENISA (Enisa, 2016). Enisa Security Infrastructure Diagram There are a number of threats that are associated with ENISA and these threats are brought to the component through a number of different agents. The security infrastructure that is necessary to be implemented in ENISA must take care of all the levels that are involved in terms of the varied threat agents in terms of nation states, social hackers, employees, cyber criminals, cyber terrorists and many others. The security infrastructure diagram that is depicted below for ENISA deals with all of these agents and the threats that are present and provides a mechanism to deal with them. ENISA Security Infrastructure Diagram Strategies to Combat Insider Threats There are a number of insider threats that are included in the top threats for ENISA in the year 2014. These threats are of significant concern for the technical experts as well as the executives. The following strategies can be applied to control and prevent the insider threats. Technological solutions that are designed for fighting with the security threats must be bundled up together with the policies associated with the resources and the projects going on in a particular organization. The behavior of the people must be tracked and recorded and a dedicated team must be employed for the same. Patterns and specific activities of dissatisfaction or rage must be given due attention. These threats are mainly executed due to the user error. It is therefore necessary to organize and conduct user trainings to allow the people to understand the system in a better manner so that there are no mistakes and errors performed from their end. Security awareness training, system trainings and likewise must be provided to the people (Musthaler, 2016). Logging, monitoring and auditing are the activities that must be executed at frequent intervals to make sure that there are no deviations internally. There are also occurrences wherein the access is not deactivated even after the termination of the employees. Such incidents should never occur and it must be ensured by the security team to deactivate the access as soon as the employee leaves the organization (Cert, 2016). Most Significant Threat Out of the top threats that have been listed, data breaches are the most significant out of all. It is because of the reason that these attacks for a major part of the entire number of attacks that took place in the year 2014 and also they have the potential and capability to cause a significant impact on the victim. There are a number of organizations and agencies that are looked upon by ENISA and the data and information that is present with each of the entity can be classified in a number of types (Ko Dorantes, 2016). The data and information that is associated with these entities can be public, private, confidential or sensitive in nature and data breach of any kind and strength violates the confidentiality, integrity and availability of the same. As per the data that has been recorded in the case study, most number of data breaches have took place in the field of health care. Health information of an individual is considered to be private and violation to the privacy of the sam e can result in legal punishments and policies. The impact of these data breaches is huge and includes a wide variety of penalties and punishments in terms of the legal and regulatory laws that govern a particular piece of information (Amato, 2016). Threat Agents and Steps to Minimize their Impact There are a number of threat agents that are involved in the execution of the top threats that have been listed in the case study. These threat agents are: Cyber Criminals: these are the agents that perform malicious activities in the cyber space and have a malicious intent to gain profits through unauthorized and illegal activities. These agents are highly skilled and capable to execute the threats. Online social hackers: These are the agents that execute the social engineering attacks and their capabilities can be classified as low to medium as far as technology is concerned. Hacktivists: These are the agents that execute the threats due to political motivation that is involved with them. Nation States: A number of nation states have developed the cyber intelligence capabilities to give rise to a number of top threats. Employees: An Insider threat that occurs and forms a significant part of the top threats is performed by these threat agents who may be internal employees, ex employees or external employees for a particular organization. Cyber Fighters and Cyber Terrorists: These are the threat agents that give base to some of the severe damage causing cyber attacks and threats (Casey, Koeberl, Vishik, 2010). The impact that is caused by these threat agents can be controlled by specific security mechanisms that must be designed to put a stop to the activities of the agents. These security mechanisms can include basic methods such as incident management, access management, physical security, firewalls, anti-malware software to advanced security measures such as cryptography, encryption, law enforcements and many others. Social Hacking Issues Social hacking is a form of security attack that is executed by the social hackers as the agents of the threats and includes the attempt to alter the social behavior of a user through a number of different means and techniques. The present era is the era of social media and the presence on this platform is almost a mandate for every single individual. The social hackers gain advantage through this phenomenon by performing dumpster diving in which the discarded user profiles and data is accessed to retrieve important information and patterns such as user name, contact information, email address and likewise. Role-playing is also a common form of the social hacking issue that includes the impersonation of a particular user or organization on a social platform to gain information. Social hacking has come up an easy way to breach the internet and network security as the presence of the users on the platform is massive and it becomes easier for the hackers to retrieve significant informat ion through a number of mechanisms. The impact of these social hacking issues can be moderate to extremely severe as these have the potential to gain sensitive and confidential information through the medium. Such unauthorized mechanism of gaining the information can then be misused by the social hackers (Wood, 2016). Trends in Threat Probability Table 2 displays the comparison between the threat landscape in the year 2013 and the year 2014. Threats such as malicious codes, web based attacks, injection attacks, denial of service, phishing, data breaches, theft, information leakage, and fraud and cyber espionage are on a rise. There has been a decrease in the threats such as spams, botnets, ransomware and explore kits as compared to the year 2013. The threat probability can thus be defined on the basis of the threats that are on a rise and are on an ever increasing pace. The increase in probability of such threats is due to the advance measures that have been devised by the attackers in association of these threats. Web based attacks can be easily executed as there is such huge amount of information and data that is present on the web based platforms. Also, malicious codes have existed since a lot many years and it has become easier for the attackers to inject the same through network as a medium that gets downloaded on the ma chine of the victim. Denial of service is also a common attack that is executed by flooding a network with huge amount of unnecessary traffic so that the service becomes unavailable as a result. It can therefore be devised that the probability of the threats is maximum in terms of web based, data breaches and physical security threats (Nichols, 2016). Improvements in ETL Processes ETL process could have been improved by including the advanced security mechanisms in the security infrastructure. There are a huge number of components and applications that are involved with ENISA and in spite of the security architecture and structure that is followed; there are frequent threats and attacks that are seen. It is prescribed to incorporate the propelled security countermeasures in the ETL procedures. Encryption is one of the key measures that ought to be embraced to maintain a strategic distance from and keep all the security dangers that are connected with the frameworks. Encryption of information very still, information in-movement and the information of the applications is a must. Sharing of information on the interpersonal interaction applications or by means of Bluetooth is a typical system that is taken after. Utilization of un-secured applications ought to be ceased from the client's end to keep away from the dangers that happen amid data sharing. Utilization of gadget passwords, for example, swipe design, pin lock or watchword to ensure the gadget ought to be empowered at all times. Passwords can likewise be put on the applications. Auto-wipe is another measure that ought to be empowered which wipes off the information after a specific number of fizzled endeavors. Testament based character and utilization of bio-measurements likewise empower appropriate realness and approval. It is also necessary to include the review, scans and monitoring of the processes and components that are involved to make sure that the security threats do not occur. There must be a set of processes in the order as basic, standardized, rationalized and dynamic that must be included (Microsoft, 2016). Challenging Threats for ENISA There are a number of security threats and challenges that are seen in the current era and there is a big list of threats that will come up as serious concerns for ENISA to battle with. These threats are classified in three broad categories as confidentiality threats, availability threats and integrity threats. Availability threats are the ones that have the potential to negatively impact the availability of a particular service such as denial of service, account hijacking, theft and fraud. Integrity threats include the unauthorized modification or alteration of the information that is associated with a particular service or application. Malicious codes, message alteration and media alteration are the integrity threats that can be difficult to battle with as these can be introduced in the system through a number of different sources. Confidentiality threats such as data breaches, information leakage, insider threats and phishing can also be difficult to deal with as they have expande d to a huge number of systems and applications (Panetta, 2016). IT Security State of ENISA ENISA should not be satisfied with its current state of IT security. There are a number of reasons that support the statement. The first and foremost in the increase in the number of threats that has been seen in the year 2014 in spite of a number of security control and prevention measures that have been taken. Also, there are a number of new threats and attacks that are being developed on a frequent basis. There are still no countermeasures that are available with ENISA to deal with them that emerges as a huge security loophole in the present state of IT security. There are also a number of threat agents that have been discussed and described in the case study. These threat agents have the ability to impact the security architecture and the information that is present with the applications, components and systems associated with ENISA. There are a huge number of different entities that are associated with ENISA and it is necessary to design security measures and policies that go ha nd in hand with the requirement of each of the system (Aws, 2016). There must be advanced security measures and mechanisms that must be adopted in addition with the security processes to develop the state of IT security in the entire infrastructure. References Amato, N. (2016). The hidden costs of a data breach. Journal of Accountancy. Retrieved 20 September 2016, from https://www.journalofaccountancy.com/news/2016/jul/hidden-costs-of-data-breach-201614870.html Aws,. (2016). Overview of Security Processes. Retrieved 20 September 2016, from https://d0.awsstatic.com/whitepapers/aws-security-whitepaper.pdf Casey, T., Koeberl, P., Vishik, C. (2010). Threat agents. Proceedings Of The Sixth Annual Workshop On Cyber Security And Information Intelligence Research - CSIIRW '10. https://dx.doi.org/10.1145/1852666.1852728 Cert,. (2016). Insider Threat Best Practices. Retrieved 20 September 2016, from https://www.cert.org/insider-threat/best-practices/ Enisa,. (2016). ENISA draws the Cyber Threat Landscape 2014: 15 top cyber threats, cyber threat agents, cyber-attack methods and threat trends for emerging technology areas ENISA. Enisa.europa.eu. Retrieved 20 September 2016, from https://www.enisa.europa.eu/news/enisa-news/enisa-draws-the-cyber-threat-landscape-2014 Ko, M. Dorantes, C. (2016). The impact of information security breaches on financial performance of the breached firms: An empirical investigation. Retrieved 20 September 2016, from https://jitm.ubalt.edu/XVII-2/article2.pdf Microsoft,. (2016). Microsoft Core Infrastructure Optimization: IT Security Processes - Best Practices for Business IT. Microsoft.com. Retrieved 20 September 2016, from https://www.microsoft.com/india/infrastructure/capabilities/itprocesses.mspx Musthaler, L. (2016). 13 best practices for preventing and detecting insider threats. Network World. Retrieved 20 September 2016, from https://www.networkworld.com/article/2280365/lan-wan/13-best-practices-for-preventing-and-detecting-insider-threats.html Nichols, A. (2016). A Perspective on Threats in the Risk Analysis Process. Sans.org. Retrieved 20 September 2016, from https://www.sans.org/reading-room/whitepapers/auditing/perspective-threats-risk-analysis-process-63 Panetta, K. (2016). Gartner's Top 10 Security Predictions 2016 - Smarter With Gartner. Smarter With Gartner. Retrieved 20 September 2016, from https://www.gartner.com/smarterwithgartner/top-10-security-predictions-2016/ Wood, P. (2016). Social hacking: The easy way to breach network security. ComputerWeekly. Retrieved 20 September 2016, from https://www.computerweekly.com/tip/Social-hacking-The-easy-way-to-breach-network-security

Brain derived neurotrophic factor ( BDNF ) Essay Example

Brain derived neurotrophic factor ( BDNF ) Essay Understanding BDNF Brain derived neurotrophic factor ( BDNF ) is a neuro-chemical ; it is portion of a household of protein molecules called neurotrophins ( Binder and Scharfman, 2004 ) . Although originally purified from the mammalian encephalon, it can besides be found in many countries of the CNS and PNS. In order of find, get downing in the early 1950 s was nerve growing factor ( NGF ) ( Levi-Montalcini and Hamburger, 1951 ) , 2nd was BDNF, which was purified from the hog encephalon ( Barde et al. , 1982 ) , so neurotrophin-3 ( NT-3 ) ( Maisonpierre et al. , 1990 ) and neurotrophin-4/5 ( NT-4 ) ( Ip et al. , 1992 ) . These four structurally related molecules constitute the protein household of mammalian neurotrophins besides known as growing factors. Neurotrophins have three chief maps: To advance the endurance of bing nerve cells ( Hempstead, 2006 ) . To excite nervous development ( Hennigan et al. , 2007 ) To bring on map of nerve cells ( Reichardt, 2006 ) , which may affect neural counsel, connectivity and synaptic malleability. Neurotrophins bind to a specific receptor in the cell membrane, which induces a conformational alteration in the cell surface receptor, therefore doing a signalling cascade that alters cistron written text and look, normally stoping in growing and ramification of the nerve cells. Interestingly, the term trophic originates from the Greek word, trophe , straight translated as nutriment. BDNF is a 12.4 kDa basic protein, which is good known for its modulatory function in the development, care and endurance of the nervous system, peculiarly in the turning embryo go oning through to adulthood. BDNF is necessary for normal development as shown by a survey of mice born without the BDNF cistron. The consequences indicated developmental defects in the encephalon and centripetal nervous system ( Ernfors et Al, . 1995 ) . Furthermore, the bulk of the mice with the BDNF strike hard out phenotype did non last passed the 2nd station natal hebdomad. The BDNF mutation mice showed a 65 % loss of nodose ganglion and a 30 % loss of lumbar dorsal root ganglion nerve cells, showing that physiological concentrations of BDNF are necessary for neural endurance of peripheral centripetal nerve cells in vivo ( Enfors et Al, . 1994a ) . Additionally, they suffered from a deficiency of vestibular maps such as co-ordination, balance and hearing due to cerebellar abnormalcies ( Fig.1. MGI datab ase: phenotypes for BDNF homozygous void mice ) . BDNF map and mechanism of action We will write a custom essay sample on Brain derived neurotrophic factor ( BDNF ) specifically for you for only $16.38 $13.9/page Order now We will write a custom essay sample on Brain derived neurotrophic factor ( BDNF ) specifically for you FOR ONLY $16.38 $13.9/page Hire Writer We will write a custom essay sample on Brain derived neurotrophic factor ( BDNF ) specifically for you FOR ONLY $16.38 $13.9/page Hire Writer Without growing factors like BDNF, nerve cells decrease in functional activity and cut down strength and figure of connexions to other nerve cells. When BDNF maps as a survival factor, it is picked up by peripheral marks via TrkB receptors, and so transported retrogradely to the cell organic structure where it will act upon cistron look and other cellular procedures. Alternatively, BDNF can be produced in cell organic structures of the PNS and CNS, where it is packaged into dense nucleus secretory cysts, and so transported anterogradely to pre-synaptic terminuss for exocytosis ( Alter et al. , 1997 ; von Bartheld, 2004 ) . BDNF is expressed by a subpopulation of little diameter centripetal nerve cells with unmyelinated axons ( C-fibres or nociceptive primary sensory nerves ) , here it is anterogradely transported to their cardinal terminuss that synapse in the superficial laminae of the spinal cord dorsal horn. BDNF is a regulator of neural irritability and modulator of synaptic mall eability in the cardinal nervous system ( Le A ; szlig ; Manns and Brigadski, 2009 ) . Assorted pre-synaptic and post-synaptic actions of BDNF have been addressed in GABAergic and glutamatergic synaptic transmittal ( Carvalho et al. , 2008 ; Lu et al. , 2008 ) . So far BDNF has been mentioned to demo a trophic consequence in sensory and vestibular nerve cells, there are besides surveies that have revealed BDNF exercising its trophic and protective belongingss on motor nerve cells ( Koliatsos et al, 1993 ) . One such survey showed that presenting BDNF after spinal cord hurt induced functional recovery ; axonal germination and protection of corticospinal nerve cells ( Sasaki et al. , 2009 ) . A 2nd survey showed that BDNF prevented excitotoxic glutamate receptor mediated cell decease in civilized embryologic rat spinal motor nerve cells. The mechanism involved the activation of the TrkB signalling pathway and the PI3 signalling tract ( Fryer et al. , 2000 ) . Furthermore, important Numberss of motor nerve cells were spared upon add-on of BDNF to lesioned neonatal sciatic nervus or facial nervus rat theoretical accounts. Another survey portrayed BDNF as an repressive agent of normal cell decease of embryologic biddy motor nerve cells ( Oppenhei m et al, 1992 ) . BDNF has besides been shown to originate the self-generated and impulse-evoked synaptic activity of turning neuromuscular synapses in civilization ( Lohof et al, 1993 ) . On the other manus, an over-expression of BDNF in the prosencephalon was seen to do acquisition and memory damages ( Cunha et al. , 2009 ) . The surveies show that BDNF plays an of import function in the development and operation of sensory and motor nerve cells. BDNF synthesis depends on ordinance by neural activity and specific sender systems ( glutamate and GABA ) . The BDNF molecule described so far is a neurotrophin in its mature signifier, it is ab initio synthesised as a pre-proprotein in the endoplasmic Reticulum ( ER ) . The pre-domain is instantly cleaved off, go forthing the direct precursor, proBDNF. ProBDNF can undergo more post-translational alterations via the Golgi setup and trans-Golgi web ( TGN ) , finally go outing in secretory cysts. The proteolytic cleavage by convertases produces the mature protein that acts on the nervous system. The convertase enzyme, Furin, is what is believed to split proBDNF into the mature homodimeric protein ( Seidah et al. , 1996 ) . BDNF secernment There are 2 secernment tracts: 1 ) the regulated tract affecting Ca2+-dependent exocytosis of secretory granules and 2 ) the constituent tract covering with specific cysts, which release their contents on attack to the plasma membrane. The spliting off procedure of the pro-domains can happen throughout both tracts ( Le A ; szlig ; mann A ; Brigadski, 2009 ) . BDNF molecules are co-stored with neuropeptides in dense nucleus cysts ; nevertheless it has been shown that they are likely to be released individually, depending on stimulation forms and frequences. For illustration, the neuropeptide, substance P is released during changeless low frequence or tetanic high frequence stimulation ( Mansvelder and Kits, 2000 ) whereas BDNF release is reliant on synaptic presence of peculiar stimulatory molecules, including extra-cellular [ Ca?+ ] and capsaicin, affecting NMDA receptors ( Lever et al. , 2001 ) . BDNF signalling tract BDNF has distinguishable signal transduction tracts, triggered by its binding to a specific receptor. There are 2 chief categories, the predominant and high affinity TrkB ( tropomyosine kinase B ) receptor and the low affinity p75NTR ( neurotrophin receptor ) . Merely upon binding of BDNF will a signal transduction pathway be activated. Binding of a putative ligand to the TrkB receptor elicits dimerisation in which the receptor becomes catalytically active ensuing in autophosphorylation ( conformational alteration ) . This is closely followed by activation of the legion signalling Cascadess, including the undermentioned intracellular tracts ( Hennigan et al, 2007 ; Binder A ; Scharfman, 2004 ) : PLC- ? 1 ( Vetter et al. , 1991 ) , PI3-K ( Atwal et al. , 2000 ) and Ras/Raf/MAPK ( Thomas et al. , 1992 ) . Briefly, there are 3 Trk neurotrophin receptor subtypes: TrkA binds NGF, TrkB binds BDNF and NT-4 and TrkC binds NT-3 ( Barbacid, 1994 ) . As antecedently mentioned, the low affinity p75 receptor, non merely binds BDNF, but besides all neurotrophins both in their precursor and mature signifiers. Lu et Al ( 2005 ) declared that mature neurotrophins tend to preferentially adhere the Trk receptor, ensuing in a pro-survival consequence, whereas the proneurotrophins, which have a higher affinity for the p75 receptor over the mature neurotrophins, appear to modulate cell decease. This led to the yin and yang theoretical account of neurotrophic action. This thesis will concentrate on the pro-survival consequence of BDNF. BDNF look BDNF activity has been observed chiefly in the hippocampus, cerebral mantle, cerebellum and basal prosencephalon. These are cardinal countries for acquisition and memory, which is why it has been associated with synaptic malleability and long term potentiation. Synaptic malleability is defined as the activity-dependent selective strengthening or weakening of a synapse between two nerve cells so that information can be collated, managed and stored in complex nervous webs ( Waterhouse and Xu, 2009 ) . Despite its terminology, BDNF look can non merely be seen in the encephalon, but besides in other countries of the CNS, the retina, motor nerve cells, the kidneys and the prostate ( Chao, 2003 ) . Besides, after peripheral nervus lesion, BDNF look was shown to increase ( Meyer et al, 1992 ) . BDNF is expressed in musculuss and is upregulated in denervated musculuss ( Griesbeck et al, 1995 ) . The old surveies provide grounds to back up the growing factor features of BDNF and for the gener alization that BDNF is widely expressed throughout the nervous system when required. A developing point being introduced is that in state of affairss of nervus harm, there are marked alterations in BDNF look. Neuropathic hurting Pain is the feeling encountered after a tissue hurt, due to a mechanical, chemical or thermic break to the excitations of the affected country. The nociceptors are activated via noxious stimulations, which fire action potencies along Ad and C fibers ( primary sensory nerve nerve cells ) towards the dorsal horn. Ad fibres detect heat, are 2-5 Â µm in diameter and have a conductivity speed of 2-5 m/s, synapsing straight on to secondary sensory nerves and go uping contralaterally via the spinothalamic piece of land. C fibres detect heat, cold, scabiess and noxious stimulations ( polymodal ) , are 0-1 Â µm in diameter and have a conductivity speed of 2-5 m/s. They enter the substantia gelatinosa of the dorsal horn laterally and synapse on an interneuron. The GABAergic interneuron synapses with a secondary sensory nerve and ascends contralaterally to higher Centres via the spinothalamic piece of land. Acute hurting is an immediate warning to the encephalon of tissue harm, signalling via nociceptive transmittal and hence moving as a mechanism of protection. Normally, nociceptive information from peripheral stimulations undergoes treating within the dorsal horn, so that the information the higher Centres of the CNS receive is a just representation of the extent of peripheral nervus hurt, regulated by inhibitory and excitant transmittal. Otherwise termed, nociceptive hurting ( Woolf and Salter, 2000 ) . Simply, a break to this system is what causes chronic hurting. Chronic hurting means that the normal inhibitory/excitatory regulation and dorsal horn processing of the nociceptive input has been disturbed. Some critical cellular, morphological and therefore functional alterations occur in the dorsal horn, which increase transmittal of noxious spinal end product taking to a more long term status. Assorted mechanisms have been implicated that influence the inhibitory/excitatory ordinan ce, which appear to meet to the engagement of neuronal-glial signalling. Neuropathic hurting can be described as a nervus hurt that evokes many alterations to happen within the peripheral and cardinal nervous system, ensuing in a serious and unwanted disfunction in the affected country, even if it appears to be healed. It is normally characterised by allodynia and hyperalgesia. Allodynia is painful sensitiveness to non-noxious stimuli e.g. a buss on the cheek. Hyperalgesia is when more hurting is felt from a noxious stimulation due to increased sensitiveness. Primary hyperalgesia refers to C-fibre sensitisation straight on the hurt site. Secondary hyperalgesia refers to dorsal horn nerve cell sensitisation environing the hurt site. There is a phenomenon called wind up in neuropathic hurting in which relentless noxious stimulation of C-fibres can ensue in drawn-out activation of dorsal horn cells. A series of consecutive wind up episodes have been linked to triping long term potentiation ( LTP ) , therefore connexions can be made with CNS synaptic malleability and memory in cardinal sensitization and neuropathic hurting. A survey in BDNF KO mice demonstrated that by bring oning nociceptive sensory nerve nerve cells in a insistent mode ( wind up ) , activity-dependent synaptic malleability of the ventral root potency greatly decreased ( Heppenstall and Lewin, 2001 ) . Neuropathic hurting that occurs after peripheral nervus hurt depends on the hyperexcitability of nerve cells in the dorsal horn of the spinal cord. After hurt, the addition in irritability induces reorganisations of the dorsal horn nerve cells. All these alterations are jointly referred to as central sensitisation ( Campbell A ; Meyer, 2006 ) . An early effect of peripheral hurt is spinal microglial activation, which leads to BDNF release ( Tsuda et al. 2005 ) . However, mechanisms involved in central sensitisation remain ill understood and the nexus between hurting and BDNF is still equivocal. BDNF in neuropathic hurting BDNF is involved with neuropathic hurting as implicated by important alterations in the degrees of BDNF look after nerve hurt to the spinal cord ( Michael et al. , 1997 ; Cho et al. , 1998 ; Zhou et al. , 1999 ; Fukuoka et al. , 2001 ; Pezet et al. , 2002 ; Merighi et al. , 2008b ) . Stimulation of nociceptors by noxious stimulations increases TrkB phosphorylation ( ERK kinase auto-phosphorylation ) in the rat spinal dorsal horn, which correlates to an addition in BDNF release in the superficial dorsal horn ( Pezet et al. , 2002a, B ) . Additionally, additions in BDNF degrees were seen via immunohistochemistry and in situ hybridisation histochemistry in uninjured dorsal root ganglion nerve cells after L5 spinal nervus ligation. Specifically in the little and average sized nerve cells ( Ad and C fibers ) did BDNF immunoreactivity and hybridisation strength for BDNF messenger RNA rise ( Fukuoka et al. , 2001 ) . Furthermore, a partial ligation of the sciatic nervus in mice resulted in an ipsilateral, important and perennial diminution in paw backdown latency from thermic stimulations. The lesion was treated with relentless intrathecal injections of a BDNF-specific antibody, which eradicated the thermic hyperalgesia. Furthermore, neuropathic hurting was blocked on application of TrkB antibodies, tyrosine kinase inhibitors and TrkB neutralizing receptor organic structures ( Yajima et al. , 2002 ) ; these molecules signify different methods of non leting the activation of the BDNF signal transduction tract. Previously mentioned in mention to wind up , was a survey that suggested BDNF in modulating neuropathic hurting by electrophysiological experiments of ventral root potencies in p4-p7 BDNF nothing mutation mice ( Hepenstall and Lewin, 2001 ) . In has been noted that BDNF modulates chloride transporter KCC2 in the hippocampus ( Rivera et al. , 2004 ) . A similar BDNF mechanism of action has been implicated for the cardinal alterations that occur in neuropathic hurting ( Coull et al. , 2003 ) . In a spinal nervus ligation theoretical account, endogenous BDNF was sequestered by a TrkB/Fc Chimera protein that wholly censored the initiation of allodynia and thermic hyperalgesia ( Bardoni and Merighi, 2008 ) . As these are the two major indexs of neuropathic hurting, their suppression by BDNF omission can merely back up the suggestion for its engagement in the neuropathic hurting mechanism. Although the bulk of research so far has portrayed BDNF as a pro-nociceptive molecule, there is besides some grounds for the converse statement that it can besides hold anti-nociceptive or analgetic effects in neuropathic hurting ( Eaton et al. , 2002 ; Lever et al. , 2003 ) . The old surveies inform us that the function of BDNF as pro-nociceptive or anti-nociceptive in neuropathic hurting is controversial. Despite this on-going argument, it is of import to appreciate that BDNF look in the spinal cord is an highly modulated procedure in neuropathic hurting theoretical accounts. Now that BDNF look in neuropathic hurting has been established, the following issue to turn to is how limited our position of neuropathic hurting has been to purely affecting neural cells. Possibly, due to miss of research and naivete, the general premise was that BDNF must be released from the primary afferent nerve cells. This prompted surveies, which foremost did non hold with this premise, and secondly changed way of BDNF beginning to another abundant cellular component of the CNS. The purpose was to better the apprehension of cardinal mechanisms and responses to peripheral nerve hurt. In recent times, research has shifted off from the function of nerve cells in neuropathic hurting and moved towards the engagement of microglia ( Watkins et al. , 2007 ) . How neuropathic hurting is propagated and maintained by astrocytes and microglia as opposed to neural influence has been of treatment in the last few old ages ( DeLeo et al. , 2004 ; Scholz and Woolf, 2007 ) . There is a sufficient sum of literature available that supports microglia holding a critical function in the induction and care of neuropathic hurting ( Inoue and Tsuda. , 2006 ; Tsuda et al. , 2005 ; Salter, 2005 ; Watkins et al. , 2001 ; Watkins and Maier, 2002 ) . Microglia need to be given more recognition than functioning every bit merely immunological entities of the CNS, taking cellular dust. Recent research authenticates that microglia have other maps as of import regulators of neuro-immune signalling, pull offing neural irritability and being a portion of the cause for the pathology of neuropathic hu rting. The deductions for the engagement of spinal cord microglia in the mechanisms of neuropathic hurting are due to the fact that microglia are widely expressed in dorsal horn synapses, they respond to neuromodulators ( e.g. ATP ) and express receptors for pain-related neurotransmitters ( e.g. P2X4 receptors ) . Current grounds for microglial-derived BDNF Experiments have been conducted that involve the targeting of siRNA against BDNF as a intervention applied to cultured microglia. The microglia were so stimulated with ATP, a molecule that is normally released after neuropathic abuse, so these activated microglia were intrathecally injected into naive rats. Administration of ATP-activated microglia, along with peripheral nervus hurt and intrathecal application of BDNF has been seen to permeate mechanical allodynia ( Coull et al. , 2005 ) . Above are three signifiers of barricading the microglial-neuronal hurting tract in vivo. Whether the beginning of BDNF is exogenic or endogenous, its application provokes a alteration in anion concentrations, chiefly chloride ions in the superficial lamina I nerve cells. The GABA receptor is activated and depolarises due to the anion reversal possible going progressively positive, this consequences in a disinhibition of lamina I dorsal nerve cells leting transmittal of neuropathic hurting. Safely b arricading the microglial-neuronal tract could be a clinical intervention of neuropathic hurting. The receptors expressed on microglia are ionotropic and metabotropic purinoceptors ( Tsuda, 2003 ; Bianco et al. , 2005 ) . Their activation is via the binding of ATP to P2X4 receptor in microglia ( Suzuki et al. , 2004 ) ; this stimulates p38 MAPK-dependent BDNF synthesis and release. The consequence is seen in the superficial spinal dorsal horn nerve cells, in which GABA suppression is reversed to GABA excitement ( Coull et al. , 2005 ) . Spinal nervus ligation, compaction and transection carnal theoretical accounts of neuropathic hurting have expressed this stimulatory response of spinal microglia ( Beggs and Salter, 2007 ) . There is grounds that suggests ATP-release occurs station nervus injury from cardinal terminuss of nociceptive sensory nerves on to the spinal dorsal horn ( Bardoni et al. , 1997 ) . ATP has been implicated to modulate both neural and damage-induced microglial activation. The communications from primary sensory nerves to microglia to secondary sensory nerve n erve cell in spinal dorsal horn are described as bi-directional, to a great extent trusting on purinergic signalling ( Di Virgilio, 2006 ) . Many surveies have shown ATP-release from nerve cells to straight modulate the operation of microglia and excite the release of immunological and neurotrophic factors, impacting the neural map ( Inoue and Tsuda, 2006 ; Tsuda et al. , 2005 ; Watkins et al. , 2001 ; DeLeo and Yezierski, 2001 ) . Zhao et Al, . ( 2006 ) stated that nociceptor derived BDNF regulates acute and inflammatory hurting, but non neuropathic hurting. They came to this decision by utilizing a peculiar technique called Cre-loxP to bring forth conditional mouse knock outs, which lacked the BDNF cistron in most nociceptive centripetal nerve cells. They were able to make this by turn uping a Na channel ( Nav1.8 ) that was specific to nociceptive primary centripetal nerve cells ; this meant that the desired BDNF cistron knock out could be restricted to this particular cell type. They used loxP sites to harbor the Nav1.8-specific BDNF cistron and so expressed Cre recombinase in these mice. As mentioned earlier, BDNF has a important function in normal nervous development so a planetary knock out is likely to hold damaging effects hence the beauty of this technique is its specificity. Therefore, the Cre-loxP method provides a safer path for happening out what happens to the behavioral and histological features of the mice when a specific cistron is non present, without interfering with its normal development. The system will be explained in more item at a ulterior point. Conditional BDNF void mice were healthy and depicted no loss of centripetal map as there is grounds demoing a typical distribution of neurofilaments, peripherinpositive nerve cells and dorsal root ganglion nerve cells in wild-type and void littermates ( Heppenstall and Lewin, 2001 ) . However, the knock out effects surfaced in pain-related behavior, instantly proposing a pain-related function for BDNF in primary sensory nerves. In BDNF void mutations, statistical analysis showed that they had a heightened sensitiveness to the stimulations so the wild-type control group ( P lt ; 0.001 ) . In drumhead, baseline thermic thresholds and carrageenan-induced thermic hyperalgesia was markedly reduced, formalin-induced hurting behavior was attenuated in the 2nd stage, which correlated with abolishment of NMDA receptor NR1 Ser896 /897 phosphorylation and ERK 1 and ERK 2 activation in the dorsal horn. NGF-induced thermic hyperalgesia was halved, and mechanical secondary hyperalgesia caused by NGF was eliminated. The above consequences are consistent with BDNF derived from nociceptive nerve cells holding a modulatory consequence in ague hurting and inflammatory hurting. Conversely, neuropathic pain behavior was non inhibited ; this suggested that either BDNF is non present in neuropathic hurting or more likely that it is derived from another cellular, cardinal beginning. The research workers used the Cre-LoxP technique as BDNF has a important function in development and to wholly take the cistron would do perinatal mortality. It allowed them to make tissue specific BDNF nothing mutation mice, which eliminated the hazard of BDNF want throughout the critical growing periods. In this instance, it gives us information about possible new drug marks and a clearer position of BDNF release and besides mechanisms of BD NF action. Familial constituents of the Cre mouse have small or no influence on pain-related behavior ( Stirling et al. , 2005 ) . Zhao et al. , suggest that by selectively taking BDNF from nociceptive centripetal nerve cells, nociceptor-derived BDNF plays an of import function in modulating inflammatory hurting thresholds and secondary hyperalgesia, but BDNF released merely from nociceptors plays no function in the development of neuropathic hurting. Hypothesis The informations so far suggests that BDNF is non released from centripetal nociceptors, but still is a critical component in neuropathic hurting. I hypothesise that microglial-derived BDNF regulates neuropathic hurting. This hypothesis can be tested by using a similar theory behind the Cre-loxP methodological analysis that Zhao et Al. ( 2006 ) used. The thought would be to strike hard out BDNF in microglia and see if neuropathic hurting is transmitted. If neuropathic hurting is mostly inhibited so this would supply grounds that microglial-derived BDNF is an of import factor of neuropathic nervus transmittal. Research OBJECTIVES Knock out BDNF from microglia. Use Cre-loxP technique to formalize recent research and possibly to see if there are clinical chances due to the high specificity of this technique. Test pain-related behavior to supply grounds that microglial-derived BDNF regulates neuropathic hurting. This would bespeak that by down-regulating BDNF in microglia, neuropathic hurting could be well inhibited. Plan of work There are surveies that have already provided grounds for the cogency of this hypothesis, every bit good as specific mechanisms of microglial-neuronal BDNF activity. However, a fresh method of consolidating this information would be to cancel BDNF in the microglia. The survey I propose is to confirm that microglial-derived BDNF is responsible for neuropathic hurting by utilizing the Cre-loxP technique to cancel BDNF cistron in microglia. The clinical relevancy of this survey would be to selectively and straight aim microglia to hold synthesis and/or release of BDNF. This would understate and possibly greatly extinguish neuropathic hurting symptoms. The clinical disadvantages of neuropathic hurting: Poor health-related quality of life for patients Large ingestion of resources and costs for the health care system Lack of specific drug interventions Weak response to normal hurting medicine Complex status Cre-loxP system It is a sophisticated, yet simple familial tool for tissue-specific omission of a cistron. The cre cistron is abbreviated from cyclization recombination, which encodes a site-specific DNA recombinase named Cre recombinase. Cre recombinase is a 38 kDa enzyme arising from bacteriophage P1. It recognises loxP sites and in return recombines them, hence catalytically removes the cistron encapsulated between two loxP sites. The bacteriophage it was ab initio discovered in uses Cre-loxP engineering for reproduction, by circularisation and helping reproduction of its genomic DNA. A LoxP site consists of a 13 bp inverted repetition, followed by an 8bp asymmetric spacer part where recombination occurs, so another 13 bp inverted repetition. Cre recombinase recognises the upside-down repetition parts. Cre recombinase showing mice strain and loxP showing mice strains are developed individually and crossed to bring forth a Cre-lox strain ( Nagy, 2000 ) . Here are some Cre-loxP strains that have been developed: Cre showing strains incorporating a transgene ( cre ) that expresses Cre recombinase, controlled by a tissue-specific booster. Inducible Cre strains incorporating a transgene that expresses a non-functional signifier of Cre recombinase that is activated upon debut of an inducement agent ( such as Vibramycin, Achromycin, RU486, or estrogen antagonist ) at a coveted clip point in embryologic development or grownup life. LoxP-flanked ( floxed ) strains incorporating a critical portion of the mark cistron for omission ( promoter sequence ) sandwiched between two loxP sites. Importantly, the Cre-loxP system is often used in mammalian systems, where tissue specific boosters allow spacial and temporal ordinance of Cre-mediated recombination [ 9 ] A. Nagy, Cre recombinase: the cosmopolitan reagent for genome tailoring, Genesis 26 ( 2000 ) , pp. 99-109. Full Text via CrossRef | View Record in Scopus | Cited By in Scopus ( 399 ) ( Nagy, 2000 ) . Experimental method utilizing microglial-specific CD11b 1 ) Coevals of CD11b-specific BDNF knock-out mice Transgenic mice incorporating the BDNF cistron surrounded by loxP sites would be mated with transgenic mice that have the cre cistron expressed in microglia merely. The resulting mice would hold the cre cistron and the loxP-flanked BDNF cistron. Wild type/normal/ homozygous = Tissues without cre cistron, express BDNF usually. KO/null/mutant/ heterozygous = Microglia will hold cre cistron, hence express Cre recombinase ; the BDNF cistron will be deleted. A booster sequence of a protein that is specific to microglia will be required for the targeted action of Cre-lox engineering. The two cardinal microglial-specific markers are CD11b and IBA-1 ( Cunha and Dias, 2009 ) . CD11b is a cell surface receptor/antigen activated in the immunological response. This type I transmembrane protein is found on monocytes, macrophages, granulocytes, some B cells, dendritic cells and natural slayer cells that facilitate cell adhesion, chemotaxis and/or phagocytosis. CD11b is frequently used as a marker of activated microglia in nervous tissue ( Oliveira et al. , 2005 ) . IBA-1 is a microglial-specific ionised calcium-binding adapter protein, besides known as allograft inflammatory factor-1, AIF-1 ( Ahmed et al. , 2007 ) . Consequences from the same survey indicate that IBA-1 is a strong marker for microglia that can be used in routinely processed mammalian tissue. Upon microglial activation, look of IBA-1 is up-regulated, this allows the favoritism bet ween resting and activated microglia. IBA-1 has been shown to co-localize with F-actin and to be indispensable for membrane rippling in response to macrophage colony-stimulating factor and phagocytosis in civilized cells ( Ohsawa et al. 2000 ) . Most immunohistochemical surveies using IBA-1 have been in non-human mammals ( Ito et al. 1998, 2001 ; Okere and Kaba 2000 ; Hirayama et Al. 2001 ) . However, a little figure of surveies have reported IBA-1 as a microglial marker in human tissue ( Ohyu et al. 1999 ) . I will farther detail the CD11b method. The cryptography sequence for the Cre recombinase cistron ( 1377 bp ) could be amplified by polymerase concatenation reaction ( PCR ) . Including the accession figure, the Cre-specific forward primer OYY21 ( 5- GGCAGTAAAAACTATCCAGC -3 ) and change by reversal primer OYY23 ( 5- TCCGGTATTGAAACTCCAGC -3 ) could be used ( Zhang et al. , 2005 ) . The Cre recombinase PCR merchandise would so be digested and cloned in the BamHI site of the D1790 vector ( Dziennis et al. , 1995 ) , downstream of the 1.7 kb-specific CD11b booster that includes transcription start site and 83 bp of 5UTR. The noncoding DNAs and polyA sequences from the human hGH ( 2154 bp ) would be included for efficient transgene look ( Ferron and Vacher, 2005 ) . The above, linearized Notl/HindIII 5235 bp transgene fragment would be injected into fertilized mouse oocytes isolated from a common inbred mouse strain and transferred to pseudopregnant females. These CD11b-Cre mice would so be crossed with a 2nd strain of mice where the BDNF cistron is flanked by Lox-P sites. This will bring forth a mouse strain with BDNF cistron omission in microglia merely. The survey population will incorporate mice with the floxed BDNF cistron and one transcript of the CD11b allelomorph ( heterozygotes ) , and the floxed BDNF littermates ( homozygotes ) will be used as controls. Alternatively, an inactive signifier of Cre recombinase could be used, so that initiation of the dual transgenic lines can be controlled through disposal of an exogenic agent. This would let microglial specific smasher of the BDNF cistron at a specific clip i.

The Concept Of Poverty Research Paper Example

The Concept Of Poverty Research Paper Example The Concept Of Poverty Paper The Concept Of Poverty Paper The term ‘poverty’ has become very common in this world today. In fact, it has been a part of the everyday language of most people. But despite the common use of this word, it concept of essence has not been grasp fully or in totality by the majority. Because of this, they are misled to what really is centered on the concept of poverty. For the many, poverty would be defined as just the absence or lack or material possessions. To other, the lack of money can be equated to poverty. On a deeper sense, poverty can be defined as the deprivation of an individual on the three basic needs for survival- food, clothing and housing. All of these definitions are deemed correct. However, the concept of poverty has come a long way. Poverty today goes beyond the lack of material possessions or the deprivation of the three basic needs of a human being. For all we know, the concept of poverty may have developed to become a subjective term. The ‘Copenhagen Declaration’ of the United Nations defines poverty as â€Å"a condition characterized by severe deprivation of basic human needs, including food, safe drinking water, sanitation facilities, health, shelter, education and information. † With this, people can be considered as poor when they are unable to eat, have access to hospital care or even go to school regardless of their income. (ThinkQuest, 2006) With this, one can say that there are different measures utilized in order to determine the state of poverty of a person. Some would employ quantitative means in order to measure poverty while other would rely on the qualitative aspect. More so, some people would emphasize the importance of the two approaches, thus the combination of it would yield the best result. The World Bank and the International Monetary Fund (Anup, 2006), have come up with a definition of poverty line to mean one dollar per day. However, this measure has been criticized by many because it can not really provide a true picture of global poverty. This is evident in the issues of poverty threshold. For instance, in the family of four in the United States, they live with eleven dollars a day in order to survive. As such, this measure of poverty is deemed not effective since it misses out much of humanity to understand the impacts. According to the U. S. Census Bureau (2007), poverty is defined at the family level and not at the household level. As such, the household can be considered as poor when the householder’s family has a total income which is below the appropriate poverty threshold. Meanwhile, there are also different criteria in determining poverty threshold. This includes the number of children, the size of the family, age and many more. In the United States, it has been claimed that in spite of the steady decline of poverty in the country, there is still a higher rate of poverty today than before. In 1998, the Census Bureau states that there are 34. 5 million Americans who are poor. Although this rate is considered as relatively low, because of the continuous decline, it is still generally higher when compared in the 1970s wherein it ranged from 11 to 12. 6 percent. Furthermore, the characteristic of poverty is America is far from uniform. Particularly, the poverty in the country varies by age, region, family composition and race. (Almanac of Policy Issues, 2007) And so, with the significant presence of poverty in the United States, there is a need for the relatively wealthy family to help the poor. More importantly, the leaders of the country are expected to devise policies which can alleviate poverty and as well as promote sustainable development for the long-term welfare of the poor.

Healing by Heart Essay Example | Topics and Well Written Essays - 2500 words

Healing by Heart - Essay Example Like many Asian communities, herbal medicine is still very important, and many of the Hmong people prefer traditional medicines to the conventional options. This can cause conflict between those working in the American healthcare industry and the patients who wish to retain their traditions, not least because traditional medicine could cause problems that would lead to healthcare providers breaking the Hippocratic Oath. Healing by Heart: Clinical and Ethical Case Stories of Hmong Families and Western Providers gives details of the issues facing both healthcare providers and the Hmong patients in society and how these may be explained and discussed from a clinical and ethical perspective. Young Woman with Kidney Failure and Transplant The story of Mai Neng Moua is an excellent example of how the Hmong people struggle to come to terms with aspects of the American healthcare system. Moua suffered from end-stage kidney disease and thus was forced to deal with the consequences of this deb ilitating illness at a very young age. Moua was forced to wait for a kidney transplant for a long time as her family refused to get tested to see if they were a match; her mother suggesting that it was better to have one person sick than two. Moua also struggled with explaining her choice to use dialysis (an example of conventional medicine) rather than the traditional Hmong remedies for her condition to her family and friends, as this was seen as breaking with traditional culture. It is clear from Moua’s writing that she suffered greatly from the consequences of her end-stage renal failure and her choice of conventional medicine was a sensible one; it is quite likely she would have died without it. Her choice to undergo a transplant was not supported by her family, although the decision was supported by her church. One of the most interesting things about this case is that Moua’s final kidney donor was a Caucasian friend, rather than any member of her community. This could be considered an example of direct diffusion as her choice reflects an adoption of the American culture she was interacting with. Moua also notes that her choice to accept the donation of a kidney from a Caucasian friend surprised the Hmong community, and helped break down some of the stereotypes of white people, because it showed generosity. It could also be seen as an example of ethnocide, particularly from the perspective of the Hmong people, as it is an example of how American culture has perhaps predominated over the traditional, particularly amongst the younger generations. Reflections The case of Mai Neng Moua is interesting from a medical anthropology perspective because it shows how traditional medicine and conventional medicine can often be at odds. It also illustrates how members of the community can ostracize those who choose the American health system over their own culture, as shown by the fact that Moua describes herself as a ‘loss to the family, to societ y in general’. Her mother seems to be the character in this story that is most confused and hurt by Moua’s decision to undergo dialysis and the eventual transplant, and is also against many other Western ideas that Moua has, such as moving in with her college roommate. Again, this shows how those among the Hmong communities in the United States may feel that their culture is being lost or destroyed (ethnocide) or becoming amalgamated into the American cult

Book Report on Playing the Enemy by John Carlin Essay

Book Report on Playing the Enemy by John Carlin - Essay Example Uniting the blacks and whites in South Africa was considered a lost cause by many people, because the divide did not only center on colour, but culture as well. The whites had a more Western-influenced culture than the blacks who clearly embraced their traditional African roots. This was the challenge that Nelson Mandela, a black South African president faced. But he, being a man who rarely gave up, knew that if there was a God in heaven, then there was hope for unity, no matter how tall the obstacle is. With this, he took upon himself to find a way to unite the two camps of humanity that shared the same land. For he too believed that, as long as we both live in the same land, â€Å"your freedom and mine cannot be separated† (Carlin, 2008, 23). The book reveals that Nelson Mandela decided to make his move in a rugby game because rugby was one of the favourite recreational sports for the white South Africans. It was a sport the blacks did not take much part in, for they deemed it a white-man’s game. But despite this, there is some influence that sports can exert to people. It has the ability to make friends out of enemies, because it helps them come together to cheer for a common interest. Carlin (2008, Page 163) showed belief in the power of sport when he mentioned Mandela’s statement, â€Å"let us use sport for the purpose of nation-building and promoting all the ideas which we think will lead to peace and stability in our country†. The team in focus were the Springboks, the then national rugby team of South Africa. A significant number of people can be found who believe that, that team was one of the best rugby teams the nation ever had. But though it represented the nation, it was entirely composed of white men, and as expected, the audience was mostly whites. Strangely, Mandela saw this as a ripe field to promote his agenda. But this was no walk in the park for the great man. He would have to gather all the charm and charisma he had amassed during his 50 years of activism, and his strategy demanded a cause all South Africans could support. His strategy was pure genius. He agreed to host the 1995 rugby world cup games in South Africa. In addition to this he endeavoured to inspire the black South Africans to develop an interest for the sport. Although not fully successful in this endeavour, he managed to get enough blacks onto his bandwagon to ensure that his plan would work out smoothly. For the Springboks, they were facing one of the giants of the sport, the gargantuan New Zealand All Blacks, a team whose unparalleled success and discipline spoke for itself. This was no easy game for the Springboks and they knew it very well. Their chances of winning were small, but greater still, their chances of winning the hearts of their black countrymen were much smaller. Carlin specified some prominent men that contributed in making that day eventful. The first individual is Francois Pienaar the six foot Captain of th e Springboks. The other one is, Linga Moonsamy, Mandela’s top bodyguard on that day. Other prominent figures are, Niel Barnard, who was once the head of the intelligence services during the apartheid-era, and Justice Bekebeke a man that had spent a significant amount of time under death sentence for committing murder, and Desmond Tutu who is revealed

History of Berlin From a Science, Arts, and Culture Perspective Berlin Research Paper

History of Berlin From a Science, Arts, and Culture Perspective Berlin and Berlin Wall - Research Paper Example For example, the Max Planck Institute for the History of Science, which is an international and interdisciplinary research institute, offers opportunities for cultural and scientific research. Indeed, Berlin City has a wide history of technology, science, and scientists. In fact, some of the great scientists in the world hail from Berlin. Albert Einstein, Alexander von Humboldt, Otto Hahn, Max Planck, Robert Koch lived, worked and carried out their research in Berlin. Most significantly, their findings and innovations had a world impact that runs from one generation to another. Born in 1769 in Berlin, Alexander von Humboldt  is one of the most celebrated  scientists in Berlin. Alexander von Humboldt  had a particular interest in scientific research on geography and propagation of plants. As such, he conducted various studies and experiments in the fields of physics, biology, chemistry, geology, and botany. He actually drew significant results where today, over 1,000 plants, ani mals, mountains, rivers and products carry his name. Additionally, Einstein, a physicist, invented the General Theory of Relativity and the discovery of the law of the photoelectric effect that gave him Nobel Prize â€Å"for his services to Theoretical Physics in 1921. His contributions formed the basis for modern electricity bringing Berlin into the world map in matters of science. Born in 1936, Gerhard Ertl won the Nobel Prize in chemistry for his â€Å"studies of chemical processes on solid surfaces in 2007. He equally established the surface chemistry in Germany and his contribution to chemistry form the basis of chemical reactions (Berlin Tourismus & Kongress GmbH Web). Another scientist from Berlin, Otto Hahn, and Lise Meitner started a research on the irradiation of uranium with neutrons. Together with Fritz Stra?mann, they succeeded in the first atom splitting in 1938. Indeed, in 1944, he won the Nobel Prize in chemistry for â€Å"his discovery of the fission of heavy (ur anium) nuclei as basis for the use of the nuclear energy†. His discovery was significant in the creation of nuclear bombs (Berlin Tourismus & Kongress GmbH Web). Actually, Germany has the world’s largest neutron user community. We also have the Berlin Academy of Science that was founded in 1712 and the Academy of the Arts founded in 1696. To date, Berlin City has seven universities of applied sciences and more than 60 other institutions making it a 'capital of science' rich in academic life. We also have the Berlin Adlershof, which is a lighthouse scientific project, combining closely-connected exchanges of scientific ideas and cooperative agreements. Through scientific inventions, a turbine engine that could generate power for mills was introduced in Berlin. Moreover, in 1877, Furbish established the first chemical pulp mill in Berlin, Forest Fiber Co.  Equally, Berlin was the first federal State to have electric lights, the power for which was generated by the hydro electric power station from the Furbish Forest Fiber Mill (Bornstein Web). Today, Berlin has a highly complex transport subject to its diverse scientific innovations. In Berlin, numerous non-university institutes play a central role in the area of optical

Child Friendly School Policies

Child Friendly School Policies The purpose of this essay is to explore what Child Friendly School policies could learn from Comparative and International Research. Reference to CFSs in Kenya will be made with emphasis on the background of CFSs, current practices and emerging critics, success stories, problems and pitfalls and what CIR can do to subjugate some of these challenges. I will start by examining the rationale for exploring CFSs, based on literature and my professional experience. Following this background will be literature surrounding the concepts of CIR and CFSs in relation to global agendas, exploring how CFSs came into existence and the driving forces behind it. I then go on to focus on a case study of CFS in Kenya, discussing the role of CIR in the Kenyas CFS, arguing that CIR is used as a political tool in creating educational policy, rather than a research method or an intellectual inquiry. I will further critically analyze challenges facing CFSs and how knowledge on CIR can contribute more effect ively to successful implementation of CFS policies. A conclusion based on the literature and authors experience will then be drawn. Throughout the essay, I build a case in favour of CIR arguing that CIR stimulates critical reflections about our educational systems by investigating commonalities and differences across national borders. Background and Rationale Comparative and international education is one of the main fields of education with many benefits, judged by the volume of studies reported in the literature. Central to this is that many countries around the world have formulated some of their educational policies based on knowledge and research from CIR. With the current wave of globalization, researchers and experts, especially in the field of education, are always trying to find ways of streamlining their educational policies with the global trends. According to Giddens (1990:64), globalization is the intensification of worldwide social relations which link distance localities in such a way that local happenings are shaped by events occurring many miles away and vice versa. Global forces therefore have an impact on shaping local practices at grass root levels. In order to do this tactically and critically, comparative and internal research remains cutting edge in informing people about the realities, the challenges and the possible effects of uncritical transfer of ideas. One of the key developments in education has been the prioritisation of basic education as opposed to adult education or higher education. In Africa, this would be probably because, as Oketch (2004) points out, basic education yields higher rates of returns compared to higher education. This has subsequently influenced government and non-governmental organizations to focus more on improving the quality of basic education. Child-friendly schools (CFSs) in Kenya is an example of a initiative sponsored by UNICEF with the aim of not just providing children right to education but the right to the right education. In other words, CFSs are more concerned with the quality of basic education in addition to its access. The emergence of CFSs in Kenya was catapulted by the forces of agendas 1 and 2 of Millenium Development Goals (MDGs) which emphasizes on the provision of basic education. One of the six Education For All (EFA) goals agreed by the World Education Forum (2002) concerns education q uality. The term quality in education is dynamic because of the social, political and economic context at which it is used. Milligan (2011:276) adds that quality has, thus, been placed as an integral cog in the educational development machine although how educational quality is defined is a matter of great contention. Because of differences in contexts, it is imperative that knowledge of comparative and international research be used in designing policies and pedagogy in CFSs that fit that particular context. Furthermore, with the fear that some countries may lag behind as others move forward, countries from sub-Sahara Africa are now engaging in various practices in order to achieve these educational goals, a race against the 2015 set deadline for attainment of EFA goals. As the clock ticks towards the year 2015, priority goals in education may change for post-2015 and the worry is further elevated. One of the efforts the government of Kenya is doing to improve the quality of education is by integrating CFS model into the basic education system. Two major questions arise here: First, how is CFS realistic considering myriad challenges facing the FPE policy in Kenya? Secondly, if integrating CFS model into basic education will help in improving the quality of education, what lessons can CFS policies learn from CIR? It is against this background that the purpose of this essay hinges. Literature Review In this section, I will look at the concepts of Comparative and International Research (CIR) and Child Friendly School (CFS) based on the literature and merge them with the global forces that influenced the emergence of CFS with an attempt to unveil the voices behind the introduction of CFS in Kenya. In addition, I will use an example of PRISM experience in Kenya to reinforce the understanding of the role of international bodies in promoting quality through well strategized and executed projects, arguing that lessons from PRISM experience can be used as insights to successful implementation of CFS policies. Concepts of Comparative and International Research (CIR) and Child Friendly School (CFS) CIR is a fusion of two broad areas of research: Comparative Research and International Research. To understand its full meaning, it is important we define the two areas of research separately. In his definition of comparative research, Mills et al (2006:621) argue that: Comparative research is a broad term that includes both quantitative and qualitative comparison of social entities. Social entities may be based on many lines, such as geographical or political ones in the form of cross-national or regional comparisons. A similar perception was echoed by Noah and Eckstein (1969:127), who viewed comparative education as an intersection of the social sciences, education and cross-national study [which] attempts to use cross-national data to test propositions about the relationships between education and society and between teaching practices and learning outcomes. In light of this definition, comparative research in the context of education can be defined as a study of two or more entities or events (Crossley Watson, 2003) with the underlying goal of searching for similarity and variance. Cross-national or regional comparisons may include comparing educational policies, pedagogy, educational leadership and so on. According to Mills et al (2006: 621), the search for variance places more emphasis on context and difference in order to understand specificities. International education, on the other hand, can be defined as the application of descriptions, analyses and insights learned in one or more nations to the problems of developing educational systems and institutions in other countries (Wilson 2000a: 116). Therefore, international research is concerned with research carried out across two or more countries, often with the purpose of comparing responses between them. This might be done in order to devise strategies that work well across both or all these cultures or to suggest local adjustments to a global strategy There is a close relationship between comparative and international education. Epstein (1994: 918) points out, that international educators use findings derived from comparative education to understand better the processes they examine, and thus, to enhance their ability to make policy. We can therefore draw from the above two definitions that CIR in education as a method of comparing both qualitative and quantitative entities in education across different countries, societies or cultures with the aim of identifying similarities and differences. It is however important to note that not all international research is comparative, and not all comparative research is international or cross-national. According to UNICEF (2007), a child-friendly school is both a child seeking school and a child-centred school: It is child seeking because it actively identifying excluded children to get them enrolled in school. It is a child-centred school because it acts in the best interests of the child leading to the realization of the childs full potential, is concerned about the whole child: her health, nutritional status, and well-being and concerned about what happens to children before they enter school and after they leave school. A CFS system recognizes and respects childrens right and responsibilities; it provides the enabling environment to realize childrens right not only in schools, but also in childrens home and their communities. These include children from conflict zones, street children and children with disabilities. According to UNICEF Global Education Strategy (2007) the Child-Friendly Schools model (see fig 1) is based on simple, rights-based concepts as described in Table 1. Concept of CFS Description Rights Based School CFS proactively seeks out-of-school children and encourages them to enrol, irrespective of gender, race, ability, social status, etc. Gender Sensitive School CFS promotes equality and equity in enrolment and achievement among girls and boys. Safe and Protective School CFS ensures that all children can learn in a safe and inclusive environment. Community Engaged School CFS encourages partnership among schools, communities, parents and children in all aspects of the education process. Academically Effective School CFS provides children with relevant knowledge and skills for surviving and thriving in life. Health Promoting School CFS promotes the physical and emotional health of children by meeting key nutritional and health care needs within schools. Table 1: Description of a CFS Fig 1: Model of the Child-Friendly School Source: UNICEF, Global Education Strategy (2007:1) The CFS model provides a framework for planning (and monitoring the effectiveness of) strategies for increasing access to quality basic education with the specific focus on the development of strategies to include those children hitherto excluded from education (UNICEF, Global Education Strategy, 2007). It is important to note that CFS model is not a one-size-fits-all model. The model may differ from country to country depending on the context. International and Local Pressures and their influences to formation of CFS in Kenya Education in sub-Sahara Africa, and indeed in Kenya, is crafted from both influences by global trends in education and the legacies of colonialism. Chisholm and Leyenderker (2008) observe that: Since 1990, the goals and purpose of education in sub-Sahara Africa has been reshaped by four interconnected developments: globalisation, the changed focus of international aid agencies towards development assistance, the adaptation of sub-Sahara African countries to the new world order with its new political emphases, and the spilling over of new pedagogical ideas from the USA and Europe into sub-Sahara Africa. (p 198) Kenya is a signatory to a number of conventions in education, including the Convention to the Rights of the Child (1989), the World Declaration on Education for All (Jomtien, 1990), the Dakar accord and the Millenium Development Goals (2000). In achievement of education development goals, Kenya is bound to, among other things, quality education by MDGs. The Jomtien call for access for access, equity, quality and democracy in education appeared to promise both social and economic development (Chisholm and Leyenderker, 2008). Social and economic development, and continues to be believed, requires educational change and educational change is necessary for social and economic development (ibid:). Educational change, in turn, is perceived to depend on, amongst other things, the input from relevant development assistance projects. These projects, in the arena of education, are typically formulated with reference to internationally negotiated development agendas (like the MDGs) and priority (Crossley Watson, 2003). An example of these projects in Kenya is CFSs which are supported by United Nations Childrens Fund (UNICEF). The Education Section of UNICEFs Programme Division introduced the Child Friendly Schools (CFS) framework for schools that serve the whole child in 1999 (Chabbott, 2004). Rationale for introducing CFS framework in Kenya The increased reliance of foreign aid to support education reform in Kenya has been accompanied by a transition, from understanding education as a human right and the general good to viewing it primarily in terms of its contribution to national growth and well-being through the development of the knowledge and skills societies are deemed to need (Arnove Torres 2007:359). Occasional voices continue insisting that education is liberating, that learning is inherently developmental (ibid: 359). With the global concern that Sub-sahara Africa countries may not achieve Universal Primary Education (UPE) by 2015 unless the progress is accelerated (Carceles et al., 2001; Bennel, 2002), Kenya responded by introducing Free Primary Education (FPE) policy in 2003 with both local and global pressure. The rationale behind introducing FPE was (apart from the pressure from global and international agendas) to alleviate poverty attributed to lack of literacy skills. The success story behind implementation of FPE policy is increased enrolment at primary school level by approximately 50% from 5.9 million in 2003 to 9.38 million pupils according to the Kenya Economic Survey 2011. However, there are myriad challenges facing the implementation of FPE policy which include high teacher-pupil ratio, inadequate infrastructure, overcrowded classroom, inadequate textbooks and many schools lacking sanitation facilities. All of these challenges militate against the provision of quality teaching. There is no magic wand for fixing this problem of quality in education. In response to this CFS were introduced in Kenya. According to UNICEF Child-friendly Schools Manual (2006:1): The challenge in education is not simply to get children into school, but also to improve the overall quality of schooling and address threats to participation. If both quality and access are tackled, children who are enrolled in primary school are likely to continue, complete the full cycle, and achieve expected learning outcomes and successfully transition to secondary school. The CFS framework (see appendix 3) aims at promoting child-seeking, child-centred, gender-sensitive, inclusive, community-involved, protective and healthy approaches to schooling and out-of-school education with a general goal of improving the quality of learning. Since CFSs are concerned with the quality of learning, it is important we look at the meaning of quality. The national examinations to obtain the Kenya Certificate of Primary Education (KCPE) at the end of primary cycle and the Kenya Certificate of Secondary Education (KCSE) at the end of secondary cycle are designed to evaluate the extent to which the primary and secondary graduates master the curriculum content. In other words, the national test scores are used as the indicators of quality. The limitation of this indicator is that it does not take into account the context at which learning takes place i.e. the learning environment, learners unique characteristics etc. There are many definitions of quality but one of the descriptions of quality which emphasizes on the context was by Tikly (2011:10) who argued that: A good quality education is one that enables all learners to realise the capabilities they require to become economically productive, develop sustainable livelihoods, contribute to peaceful and democratic societies and enhance wellbeing. The learning outcomes that are required vary according to context but at the end of the basic education cycle must include threshold levels of literacy and numeracy and life skills including awareness and prevention of disease. In his description, Tikly believes that a good quality education arises from interactions between three overlapping environments, namely the policy, the school and the home/community environments. In his perception of quality education, Tikly puts context into consideration i.e. needs of the learner, cultural and political contexts. In addition, he emphasizes on the relevance of what is taught and learned and how it fits the nature of particular learners in question. This encourages policy makers to take cognisance of changing national development needs, the kinds of schools that different learners attend and the forms of educational disadvantage faced by different groups of learners when considering policy options'(ibid:11). The fact that CFS emphasizes on learner-centered pedagogy and puts the child at the centre or focal point in the learning process raises the idea of what is regarded as valuable knowledge and how this knowledge is acquired in this particular context. This leads us to the inquiry on the school of thought or paradigm behind introducing a contextualized CFS framework. CFS as an approach to education is premised on constructivism, a theory of knowledge arguing that humans generate knowledge and meaning from interaction between ideas and real experiences. According to constructivists, the notions of reality and truth are socially constructed and in different context with the understanding that knowledge is subjective and embedded in multiple realities. Thus, quality of learning should be viewed in the context in which it is occurs. Towards Quality Basic Education In Kenya: Developing Research Capacity and Evaluation Before we acknowledge the contribution of CFS in providing quality education to the children at Primary school level, it will be prudent to review some of other contributions that has been made by international organizations in collaborations with the local government in promoting quality of education at grassroot levels in building research capacity. Kenya has had a history of benefiting from international assistance in its education sector. One of the programmes is the Primary Schools Management (PRISM), an initiative of DfID through the Ministry of Education, which places a lot of emphasis on participatory approaches and emphasis on mobilising community support, resource management and utilisation, supporting learning of pupils and developing action plans. It targeted teacher training and management and the impact of this is overall effectiveness of an education system which has a direct bearing on quality of education. According to Otieno Colclough (2009:26), PRISM is regarded as one of donor-funded programmes which had most positive impact on quality of basic education and CFS can learn from it. As Crossley et al (2005) note, the main objective of PRISM was to improve the quality of primary education through the training and support of head teachers in practical management skills. Borrowing from the PRISM experience it is wo rthy learning that well planned and organized CFSs policies involving community participation at grass root level could help amplify local voices and lead to successful implementation of educational policies not only in Kenya but also other parts of African contexts. Challenges in implementing CFS in Kenya In this section I will explore common challenges associated with the CFSs with an aim of illuminating and critiquing the gap between policy and practice in CFSs. Access and Quality Dilemma: Which one should be first priority? As I mentioned earlier, one of the role of CFS in Kenya is to improve the quality of learning. But the access to education is still a challenge in Kenya and there is fear that Kenya will not have achieved EFA goals 1 and 2 by the year 2015. Many comparative researchers argue that different countries have different educational problems and it is the countrys obligation to identify what should be the priority and why. Aksoy (2008: 218) observes that: While developed countries are mainly engaged in activities to increase the quality of education, or they practice and seek new techniques and methods of learning and teaching, developing countries struggle to provide equal opportunities for education, trying to increase the rate of participation of all citizens in basic education, which is actually compulsory. To deal with its educational problems, each country works out countrywide or local solutions, depending on the nature of the problem. The tone of such statement is more closely allied to the question of priority. Priority in one country may not be a priority in another. In Kenya, the major problem basic education is facing is of access while higher education is facing the problem of quality. CFS focus more on quality, but in the Kenyan context, access to education is still a problem in basic education even after the introduction of FPE. The CFS concept of quality can however suit very well in some small state commonwealth countries which have almost universal access to basic education. It has been noted that small sates have now shifted education priorities towards focus in school effectiveness, quality and inclusion (Crossley, 2002) after ensuring that all children have accessed basic education and CFSs in Kenya should learn from small states that the priority should now be on access to basic education before shifting to quality. Atomizing the child: is child-centred the solution to quality CFS? A key feature of a right-based, CFS system is that it is linked tightly to the child-centred learning process. CFS advocates for child-centred learning where a child is treated as a single entity or an atom in learning processes. The idea of atomizing a child has its drawbacks derived from child-centred learning. First, there is an oversight on early year development behaviour of the child. Psychologists believe children undergo various levels of development and their learning behaviours are different at each level. For instant, Vygotskys (1978) concept of the zone of proximal development (ZPD) implies that a child cannot ordinary create ZPD by himself; he needs the more expert individual to bridge the gap between his current development level and his proximal level of development. Secondly, a child-friendly, democratic learning environment may not work successful in overcrowded classrooms and school with limited resources like it is the case in Kenya. Thirdly, child-centred learning weakens the role of the teacher. The idea that a child must be active in construction of knowledge is often understood to imply a diminishing role for the teacher in learning process who now becomes a coach or a facilitator. A call for paradigm renovation, from an exclusively child-centred learning to a combination of both child-centred learning and teacher-centred learning approach is important so that the weakness of one method is complemented by the other method. What Lessons can Kenya learn from other Countries in Implementing CFS? A Review on the Contribution of Comparative Research King (2007) emphasizes the need to explore the tension between the national and the international policy agendas in Kenya in order to make informed decisions when crafting educational policies. Clearly, this is a view that acknowledges the contribution of CIR researchers in bridging theories, policies and practices with both local and global minds (Crossley, 2000) in trying to identify betters grounds to critically reflect and determine appropriate course of action. Apparently, the term that is commonly used in Kenya and indeed many Africa countries in the initial processes of designing an educational policy is benchmarking. Essentially, this is usually a comparative study which is carried out locally and/or internationally in trying to compare different models of policy framework with the aim of critical adaption or adoption. Lessons are well learnt when a comparisons are made, and this underscores the strength and significance of comparative research. Moreover, since problems transcend national borders, it is prudent to seek possible solutions by learning from a similar experience in another country, and this explains why international research is important. Kenya can learn from other countries that are either progressing or failing to implement CFS policies because lessons can either identify opportunities or gaps, based on comparative analysis. In these respect therefore, I have identified two key elements of CIR which could help implementat ion of CFS. The first element is on identification of the gap between policy and practice. Documenting the emerging good practices and lessons learned within the regions is useful in informing evidence based programming and advocacy to enable us to achieve better results. For example, a Global Evaluation Report published by UNICEF in 2009 on comparative studies of how to six countries (Guyana, Nicaragua, Nigeria, Philippines, South Africa, Thailand) with different experiences implementing CFS, demonstrated the following: CFSs in varying contexts successfully apply the three key principles of CFS models-inclusiveness, child-centredness and democratic participation. Schools operating in very different national contexts, with different levels of resources and serving populations with different needs have succeeded in being child-centred, promoting democratic participation, and being inclusive. Schools that had high levels of family and community participation and use of child-centred pedagogical approaches had stronger conditions for learning, that is, students felt safer, supported and engaged, and believed that the adults in the school supported the inclusion and success of each student. (UNESCO, 2009) Kenya can use this success report to assist in providing a broader perspective on the ways in which CFSs can contribute to quality in the countrys unique context. The caution should however be that any steps taken should have hindsight of the current context in the country to avoid uncritical transfer of practice which may end up opening a Pandoras box. Secondly, through CIR, studies of educational systems from countries that share similar problems or pitfalls can provide information for learning possible consequences. A recent comparative evaluation research conducted by UNESCO in Nigeria, Gunaya, Thailand and the Philippines on CFS pedagogy gave different findings. While teachers in Nigeria and Guyana mainly focused on meeting basic instructional material needs (textbooks, paper), many teachers in Thailand and the Philippines focused on having greater access to information and communication technology (UNESCO 2009). Kenya experiences the same challenge as Nigeria and Gunaya, and data from these countries can be used to learn how they coping with inadequate basic instructional material. The caution here should be, that common problems may prevail in different countries, but common model cannot be applied because every country has different culture/context (Crossley Watson, 2003: 39). This provides invaluable information of what to adopt, modify or avoid. Conclusion It is worthy reiterating Crossley'(2003) emphasis that context matters and different countries have different needs and priorities even if they are faced with the same challenges. The value of CIR is studying foreign systems of education in order to become better fitted to study and understand our own (Sadler 1900, reprinted 1964:310) and CIR can be used as a lense to focus on adaptable or adoptable practices. UNICEF repeatedly emphasises that CFS is a pathway to educational quality rather than a blueprint and that it is counterproductive to regard the CFS model as rigid, with a present number of defining characteristics or key components (2009c, Ch. 1, p. 9). Thus, the essay sought to present an overview in favour of the contribution of CIR by highlighting what CFS policies in the Kenyan context could learn from CIR. As such, the essay acknowledges the role of CIR in stimulating critical thinking and reflections about CFSs system by evaluating its success and failures, strengths and weaknesses. This critical reflection facilitates self evaluation in our own context and the basis for determining appropriate courses of action. The essay also hints that CIR helps us understand global agendas and how they shape educational development projects from organizations and development agencies.